Strain Name:
C57BL/6J-MtgxR5782Btlr/Mmmh
Stock Number:
043379-MU
Citation ID:
RRID:MMRRC_043379-MU
Other Names:
R5782 (G1)
Major Collection:

Strain Information

Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22173
Homologene: 30969
Agt
Name: angiotensinogen
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Trpc2
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2b, TRPC2a, mTrp2, trp2, Trrp2, 3010009O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22064
Homologene: 135989
Khdc4
Name: KH domain containing 4, pre-mRNA splicing factor
Synonyms: 2810403A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74200
Homologene: 41761
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Cep83
Name: centrosomal protein 83
Synonyms: 2600001G24Rik, 5730513H21Rik, 4921537D05Rik, Ccdc41
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 77048
VEGA: 10
Homologene: 9396
Cuedc1
Name: CUE domain containing 1
Synonyms: C330016O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 103841
Homologene: 9933
Armh3
Name: armadillo-like helical domain containing 3
Synonyms: 9130011E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71617
VEGA: 19
Homologene: 15843
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: 5033407O22Rik, 4833414K03Rik, Ltpr7, CHAK1, CHAK, TRP-PLIK, 2310022G15Rik, LTRPC7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58800
Homologene: 9774
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382034
Homologene: 40964
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 2410104C19Rik, 9530048I21Rik, 3010027A04Rik, Yod
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 77087
Homologene: 69134
Cse1l
Name: chromosome segregation 1 like
Synonyms: Cas, Capts, 2610100P18Rik, Xpo2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110750
HGNC: HGNC:2431
Homologene: 1006
Brwd1
Name: bromodomain and WD repeat domain containing 1
Synonyms: 5330419I02Rik, D530019K20Rik, G1-403-16, Wdr9, repro5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 93871
Homologene: 23130
Atxn2
Name: ataxin 2
Synonyms: ATX2, 9630045M23Rik, Sca2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20239
Homologene: 2234
Parg
Name: poly (ADP-ribose) glycohydrolase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 26430
Homologene: 50532
Zfp318
Name: zinc finger protein 318
Synonyms: TZF, 2610034E08Rik, D530032D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57908
Homologene: 22808
Psen1
Name: presenilin 1
Synonyms: S182, PS1, PS-1, presenilin-1, Ad3h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 19164
VEGA: 12
HGNC: HGNC:9508
Homologene: 7186
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66725
Homologene: 18982
Zzz3
Name: zinc finger, ZZ domain containing 3
Synonyms: 3110065C23Rik, 6430567E01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 108946
Homologene: 9182
Smc6
Name: structural maintenance of chromosomes 6
Synonyms: 2810489L22Rik, 3830418C19Rik, Smc6l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 67241
VEGA: 12
Homologene: 41575
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23966
Homologene: 8034
Zfp740
Name: zinc finger protein 740
Synonyms: 1110034O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 68744
Homologene: 129530
Psma6
Name: proteasome subunit alpha 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 26443
HGNC: HGNC:9535
Homologene: 2085
Lzts1
Name: leucine zipper, putative tumor suppressor 1
Synonyms: F37, FEZ1, PSD-Zip70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 211134
Homologene: 10873
Hspa13
Name: heat shock protein 70 family, member 13
Synonyms: B230217N24Rik, 60kDa, 1600002I10Rik, Stch
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 110920
Homologene: 5062
Cdc20
Name: cell division cycle 20
Synonyms: p55CDC, 2310042N09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 107995
HGNC: HGNC:1723
Homologene: 37459
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MD44, MTSG1, Atip1, B430305I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102103
Homologene: 100292
Rap1gds1
Name: RAP1, GTP-GDP dissociation stimulator 1
Synonyms: GDS1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229877
HGNC: HGNC:9859
Homologene: 41422
Tsku
Name: tsukushi, small leucine rich proteoglycan
Synonyms: 9530051K01Rik, Lrrc54
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244152
Homologene: 41045
Kcnk2
Name: potassium channel, subfamily K, member 2
Synonyms: TREK-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16526
HGNC: HGNC:6277
Homologene: 7794
Klf7
Name: Kruppel-like transcription factor 7 (ubiquitous)
Synonyms: 9830124P08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 93691
HGNC: HGNC:6350
Homologene: 2751
Vav1
Name: vav 1 oncogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22324
Homologene: 3961
Reln
Name: reelin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Adamtsl3
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269959
Homologene: 18912
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D830007G01Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Kctd18
Name: potassium channel tetramerisation domain containing 18
Synonyms: 4932411A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 51960
Homologene: 12710
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Stk31
Name: serine threonine kinase 31
Synonyms: C330007K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 77485
Homologene: 12677
Ptpro
Name: protein tyrosine phosphatase receptor type O
Synonyms: D28, PTPROt, PTP-phi, PTP-BK, PTP-U2, GLEPP1, PTP-oc, Ptpn15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19277
HGNC: HGNC:9678
Homologene: 21564
Vmn2r61
Name: vomeronasal 2, receptor 61
Synonyms: Casr-rs2, EG637873, Gprc2a-rs2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 637873
Homologene: 129683
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22635
Homologene: 124417
Cyp2j9
Name: cytochrome P450, family 2, subfamily j, polypeptide 9
Synonyms: 8430417E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74519
HGNC: HGNC:2634
Homologene: 137388
Cdk5rap3
Name: CDK5 regulatory subunit associated protein 3
Synonyms: 1810007E24Rik, OK/SW-cl.114, MST016, HSF-27, IC53, C53
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 80280
Homologene: 12718
Zfp575
Name: zinc finger protein 575
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101544
Homologene: 45485
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 628870
Homologene: 46008
Pcnx2
Name: pecanex homolog 2
Synonyms: E330039K12Rik, Pcnxl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Atrnl1
Name: attractin like 1
Synonyms: Alp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226255
VEGA: 19
Homologene: 45809
Trbc2
Name: T cell receptor beta, constant 2
Synonyms: BB153276, Tcrb-C2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 100125263
Slc34a1
Name: solute carrier family 34 (sodium phosphate), member 1
Synonyms: renal Na+/Pi transporter, Na/Pi cotransporter, Slc17a2, Npt2, NaPi-IIa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20505
VEGA: 13
Homologene: 20663
Zfp267
Name: zinc finger protein 267
Synonyms: D3Ertd254e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 241944
Homologene: 117700
Arhgef19
Name: Rho guanine nucleotide exchange factor 19
Synonyms: 6430573B13Rik, WGEF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 213649
Homologene: 17710
Slfn8
Name: schlafen 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276950
Homologene: 45432
Or14c45
Name: olfactory receptor family 14 subfamily C member 45
Synonyms: GA_x6K02T2NHDJ-9587747-9586815, MOR220-3, Olfr297
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258611
Homologene: 115526
Stk36
Name: serine/threonine kinase 36
Synonyms: 1700112N14Rik, Fused
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269209
Homologene: 49432
Sult2b1
Name: sulfotransferase family, cytosolic, 2B, member 1
Synonyms: SULT2B, Gm5897
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 54200
Homologene: 49487
Cox4i2
Name: cytochrome c oxidase subunit 4I2
Synonyms: Cox IV-2, Cox4b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 84682
Homologene: 13082
Saxo1
Name: stabilizer of axonemal microtubules 1
Synonyms: 4930500O09Rik, Fam154a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 75811
Homologene: 27548
Actl9
Name: actin-like 9
Synonyms: 1700029I08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 69481
Homologene: 77642
Ubash3a
Name: ubiquitin associated and SH3 domain containing, A
Synonyms: 5830413C03Rik, Sts-2, TULA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 328795
Homologene: 56833
Foxa1
Name: forkhead box A1
Synonyms: Tcf-3a, Hnf-3a, Tcf3a, Hnf3a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 15375
VEGA: 12
HGNC: HGNC:5021
Homologene: 3307
Or52e5
Name: olfactory receptor family 52 subfamily E member 5
Synonyms: GA_x6K02T2PBJ9-7698491-7699432, MOR32-5, Olfr678
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258753
Homologene: 27254
Slc2a10
Name: solute carrier family 2 (facilitated glucose transporter), member 10
Synonyms: Glut10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 170441
Homologene: 38551
Mtres1
Name: mitochondrial transcription rescue factor 1
Synonyms: 1700021F05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67851
Homologene: 41137
Lcn12
Name: lipocalin 12
Synonyms: 9230102M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 77701
Homologene: 52272
Six4
Name: sine oculis-related homeobox 4
Synonyms: AREC3, TrexBF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20474
Homologene: 69089
Myl2
Name: myosin, light polypeptide 2, regulatory, cardiac, slow
Synonyms: MLC-2v, MLC-2, Mlc2v, Mylpc, Gm32672
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 17906
HGNC: HGNC:7583
Homologene: 55462
Pcdhga3
Name: protocadherin gamma subfamily A, 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93711
HGNC: HGNC:8701
Homologene: 75100
Zfp1002
Name: zinc finger protein 1002
Synonyms: Gm21994
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,058,600 bp
  • A to G, chromosome 1 at 57,959,237 bp
  • C to T, chromosome 1 at 64,042,411 bp
  • T to A, chromosome 1 at 74,605,425 bp
  • T to G, chromosome 1 at 189,256,579 bp
  • A to T, chromosome 2 at 25,493,757 bp
  • T to A, chromosome 2 at 52,264,047 bp
  • T to A, chromosome 2 at 76,776,011 bp
  • T to C, chromosome 2 at 126,797,714 bp
  • T to C, chromosome 2 at 150,255,518 bp
  • A to C, chromosome 2 at 152,764,811 bp
  • C to A, chromosome 2 at 165,514,838 bp
  • A to G, chromosome 2 at 166,929,001 bp
  • T to C, chromosome 3 at 36,164,979 bp
  • T to G, chromosome 3 at 88,711,678 bp
  • C to G, chromosome 3 at 138,959,079 bp
  • A to G, chromosome 3 at 152,428,100 bp
  • T to A, chromosome 4 at 86,445,807 bp
  • C to T, chromosome 4 at 96,573,905 bp
  • T to C, chromosome 4 at 118,433,042 bp
  • C to A, chromosome 4 at 141,256,312 bp
  • C to T, chromosome 5 at 22,018,056 bp
  • T to C, chromosome 5 at 121,797,310 bp
  • T to A, chromosome 5 at 122,104,870 bp
  • C to T, chromosome 5 at 137,420,007 bp
  • A to G, chromosome 6 at 41,546,937 bp
  • T to G, chromosome 6 at 49,469,136 bp
  • A to G, chromosome 6 at 113,548,872 bp
  • A to T, chromosome 6 at 137,399,498 bp
  • C to A, chromosome 7 at 24,585,602 bp
  • T to A, chromosome 7 at 42,299,829 bp
  • C to T, chromosome 7 at 45,731,346 bp
  • T to A, chromosome 7 at 82,540,286 bp
  • T to A, chromosome 7 at 86,527,213 bp
  • C to T, chromosome 7 at 87,493,016 bp
  • A to G, chromosome 7 at 96,893,039 bp
  • A to T, chromosome 7 at 98,352,850 bp
  • A to G, chromosome 7 at 102,083,979 bp
  • T to C, chromosome 7 at 105,069,749 bp
  • T to A, chromosome 8 at 41,082,727 bp
  • A to T, chromosome 8 at 69,140,698 bp
  • T to C, chromosome 8 at 120,566,521 bp
  • A to G, chromosome 8 at 122,900,017 bp
  • A to T, chromosome 8 at 124,557,131 bp
  • A to G, chromosome 8 at 125,753,484 bp
  • T to C, chromosome 10 at 43,532,903 bp
  • A to T, chromosome 10 at 94,749,032 bp
  • G to A, chromosome 10 at 107,777,117 bp
  • G to T, chromosome 11 at 83,017,041 bp
  • A to G, chromosome 11 at 88,170,032 bp
  • A to G, chromosome 11 at 96,911,586 bp
  • G to C, chromosome 12 at 11,290,834 bp
  • A to G, chromosome 12 at 55,410,256 bp
  • T to A, chromosome 12 at 57,542,516 bp
  • A to G, chromosome 12 at 73,104,058 bp
  • T to A, chromosome 12 at 83,712,459 bp
  • A to G, chromosome 13 at 55,402,688 bp
  • A to T, chromosome 14 at 32,274,905 bp
  • A to T, chromosome 15 at 91,702,183 bp
  • G to T, chromosome 15 at 102,208,366 bp
  • C to A, chromosome 16 at 75,758,097 bp
  • A to T, chromosome 16 at 96,043,043 bp
  • G to A, chromosome 17 at 31,235,503 bp
  • A to T, chromosome 17 at 33,433,761 bp
  • TGAAGAAGAAGAAGAAGAAGAAGAAGAAG to TGAAGAAGAAGAAGAAGAAGAAG, chromosome 17 at 46,412,514 bp
  • T to C, chromosome 17 at 57,296,001 bp
  • C to T, chromosome 18 at 37,676,300 bp
  • A to G, chromosome 19 at 45,886,027 bp
  • G to T, chromosome 19 at 57,753,286 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5782 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043379-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.