Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5782Btlr/Mmmh
Stock Number:
043379-MU
Citation ID:
RRID:MMRRC_043379-MU
Other Names:
R5782 (G1)
Major Collection:

Strain Information

Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22173
Homologene: 30969
Agt
Name: angiotensinogen
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Trpc2
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2b, TRPC2a, mTrp2, trp2, Trrp2, 3010009O07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22064
Homologene: 135989
Khdc4
Name: KH domain containing 4, pre-mRNA splicing factor
Synonyms: 2810403A07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74200
Homologene: 41761
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Cep83
Name: centrosomal protein 83
Synonyms: 2600001G24Rik, 5730513H21Rik, 4921537D05Rik, Ccdc41
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77048
VEGA: 10
Homologene: 9396
Cuedc1
Name: CUE domain containing 1
Synonyms: C330016O16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103841
Homologene: 9933
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,058,600 bp
  • A to G, chromosome 1 at 57,959,237 bp
  • C to T, chromosome 1 at 64,042,411 bp
  • T to A, chromosome 1 at 74,605,425 bp
  • T to G, chromosome 1 at 189,256,579 bp
  • A to T, chromosome 2 at 25,493,757 bp
  • T to A, chromosome 2 at 52,264,047 bp
  • T to A, chromosome 2 at 76,776,011 bp
  • T to C, chromosome 2 at 126,797,714 bp
  • T to C, chromosome 2 at 150,255,518 bp
  • A to C, chromosome 2 at 152,764,811 bp
  • C to A, chromosome 2 at 165,514,838 bp
  • A to G, chromosome 2 at 166,929,001 bp
  • T to C, chromosome 3 at 36,164,979 bp
  • T to G, chromosome 3 at 88,711,678 bp
  • C to G, chromosome 3 at 138,959,079 bp
  • A to G, chromosome 3 at 152,428,100 bp
  • T to A, chromosome 4 at 86,445,807 bp
  • C to T, chromosome 4 at 96,573,905 bp
  • T to C, chromosome 4 at 118,433,042 bp
  • C to A, chromosome 4 at 141,256,312 bp
  • C to T, chromosome 5 at 22,018,056 bp
  • T to C, chromosome 5 at 121,797,310 bp
  • T to A, chromosome 5 at 122,104,870 bp
  • C to T, chromosome 5 at 137,420,007 bp
  • A to G, chromosome 6 at 41,546,937 bp
  • T to G, chromosome 6 at 49,469,136 bp
  • A to G, chromosome 6 at 113,548,872 bp
  • A to T, chromosome 6 at 137,399,498 bp
  • C to A, chromosome 7 at 24,585,602 bp
  • T to A, chromosome 7 at 42,299,829 bp
  • C to T, chromosome 7 at 45,731,346 bp
  • T to A, chromosome 7 at 82,540,286 bp
  • T to A, chromosome 7 at 86,527,213 bp
  • C to T, chromosome 7 at 87,493,016 bp
  • A to G, chromosome 7 at 96,893,039 bp
  • A to T, chromosome 7 at 98,352,850 bp
  • A to G, chromosome 7 at 102,083,979 bp
  • T to C, chromosome 7 at 105,069,749 bp
  • T to A, chromosome 8 at 41,082,727 bp
  • A to T, chromosome 8 at 69,140,698 bp
  • T to C, chromosome 8 at 120,566,521 bp
  • A to G, chromosome 8 at 122,900,017 bp
  • A to T, chromosome 8 at 124,557,131 bp
  • A to G, chromosome 8 at 125,753,484 bp
  • T to C, chromosome 10 at 43,532,903 bp
  • A to T, chromosome 10 at 94,749,032 bp
  • G to A, chromosome 10 at 107,777,117 bp
  • G to T, chromosome 11 at 83,017,041 bp
  • A to G, chromosome 11 at 88,170,032 bp
  • A to G, chromosome 11 at 96,911,586 bp
  • G to C, chromosome 12 at 11,290,834 bp
  • A to G, chromosome 12 at 55,410,256 bp
  • T to A, chromosome 12 at 57,542,516 bp
  • A to G, chromosome 12 at 73,104,058 bp
  • T to A, chromosome 12 at 83,712,459 bp
  • A to G, chromosome 13 at 55,402,688 bp
  • A to T, chromosome 14 at 32,274,905 bp
  • A to T, chromosome 15 at 91,702,183 bp
  • G to T, chromosome 15 at 102,208,366 bp
  • C to A, chromosome 16 at 75,758,097 bp
  • A to T, chromosome 16 at 96,043,043 bp
  • G to A, chromosome 17 at 31,235,503 bp
  • A to T, chromosome 17 at 33,433,761 bp
  • TGAAGAAGAAGAAGAAGAAGAAGAAGAAG to TGAAGAAGAAGAAGAAGAAGAAG, chromosome 17 at 46,412,514 bp
  • T to C, chromosome 17 at 57,296,001 bp
  • C to T, chromosome 18 at 37,676,300 bp
  • A to G, chromosome 19 at 45,886,027 bp
  • G to T, chromosome 19 at 57,753,286 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5782 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043379-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.