Loading Mouse GIF
Loading...

Strain Name:
STOCK Atoh1tm1(Neurog1)Bfri/Mmmh

Stock Number:
043528-MU
Citation ID:
RRID:MMRRC_043528-MU
Other Names:

Atoh1 kiNeurog1, AtkiNgn1, Atoh1tm1Bfri

Strain Information

Atoh1tm1(Neurog1)Bfri
Name: atonal bHLH transcription factor 1; targeted mutation 1, Bernd Fritzsch
Synonyms: Atoh1KINeurog1, Atoh1tm1Bfri
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Knock-In
Neurog1
Name: neurogenin 1
Synonyms: neurogenin, Math4C, ngn1, neurogenin 1, Neurod3, bHLHa6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18014
VEGA: 13
HGNC: HGNC:7764
Homologene: 4490
Atoh1
Name: atonal bHLH transcription factor 1
Synonyms: Math1, Hath1, bHLHa14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11921
HGNC: HGNC:797
Homologene: 31297
Genetic Alterations
The reading frame of Atoh1, Gene ID 11921 (human ortholog: Gene ID 474) was replaced with the reading frame of Neurog1 retaining all Atoh1 enhancers to drive Neurog1 instead of Atoh1.
Genotype Determination
ES Cell Line
R1 derived from (129X1/SvJ x 129S1/Sv)F1-Kitl+
Phenotype

Homozygous: Only the inner ear of all the different cell types that express Atoh1 has been analyzed thus far. Mice homozygotic for the Neurog1 knockin develop hair cell precursors that express Neurog1 and Neurod1 (regulated by Neurog1). However, only few highly aberrant hair cells develop. If combined with a delayed deletion of the floxed Atoh1 allele near normal but non-finctional hair cells develop.

Hetero/Hemizygous: Heterozygous mice with a wildtype Atoh1 allele have minor aberrations of hair cells. However, if the second allele of Atoh1 is floxed and recombined with a delay using the Atoh1-cre line, seemingly near normal hair cells differentiate that do not function.

Cre-excised Phenotype: Undetermined

The replacement of Atoh1 by Neurog1 results in loss of most hair cell differentiation but initial formation of precursors that express Neurog1 and Neurod1 (PMID22292060). However, in the heterozygotic state (Atoh1+/kiNeurog1) there is only limited effect on hair cell development. In contrast, if the native floxed Atoh1 allele is recombined with a delay, Neurog1 is able to rescue nearly all inner hair cells and most outer hair cells (PMID26209643). Despite presence of many hair cells most of which are near normal, these mice are completely deaf but show DPOAE, suggesting that the few remaining OHC are functional (unpublished observations).

Strain GQC Summary
Stock strain carrying the tm1(Neurog1)Bfri allele of the Atoh1 gene on mixed background. The genetic background cannot be resolved for most of the genome with MiniMUGA. The knock-in present on chromosome 6 is on the donor background (129X1 or 129S1). 129P2/OlaHsd, 129S1/SvImJ, 129S4/SvJaeJ, 129S5/SvEvBrd, 129X1/SvJ, BALB/cAnNHsd, C57BL/6J, C57BL/6NCrl,C57BL/6NRj, FVB/NCrl, and FVB/NJ were detected with diagnostic alleles. The genome of this strain is not replicable. This GQC report is based on the MiniMUGA G3 2024 pipeline using 2 samples genotyped in 2019.
MMRRC Strain GQC Report
Suggested Control Mice
Littermates of all relevant genotypes.
  • Apoptosis
  • Cell Biology
  • Developmental Biology
  • Neurobiology
  • Sensorineural
Submitter
Bernd Fritzsch, Ph.D., University of Iowa.
Strain Development

Plasmids used. Six plasmid clones were utilized for the construction of the KI targeting vector. The pCS2-MT-Ngn1 plasmid was kindly provided by Dr. Qiufu Ma. This plasmid contains the full-length coding region of mouse Neurog1 that was cloned into the pCS2-MT [PMID7926743] vector from its original cDNA Bluescript plasmid (pBS) [PMID8858147]. Both the pPGKneo-II (GenBank ID:AF335420) [28] and the PGKdtabpA [PMID9226440] plasmids were obtained from the University of Nebraska Medical Center Mouse Genome Engineering Core Facility, Omaha, NE. pIRES2-DsRed2 was purchased from Clonetech (Mountain View, CA). Two pBSII KS clones containing genomic fragments isolated from a mouse 129/SvEv genomic DNA library (Stratagene) were kindly made available by Dr. Huda Zoghbi [PMID9367153]. The pMath1-5 -9 plasmid contained an EcoRI/ApaI 10.5 kb fragment of the Atoh1 locus. This fragment contains the 5 flanking fragment (5.06 kb), the Atoh1 open reading frame ( 1.06 kb) and a 4.38 kb 3 flanking sequence. The second plasmid, pApa4.2, contains a 4.54 kb ApaI fragment that represents 164 bp of the 3 end of the Atoh1 coding sequence and a 4.38 kb sequence of the downstream 3 fragment.Construction of the Atoh1KINeurog1 plasmid.An initial plasmid was produced where a 1.29 kb IRES2-DsRed2 sequence was inserted 3 to the 6XMyc-mNeurog1 sequence in the pCS2-MT-Ngn1 plasmid. The single NotI site in the original pIRES2-DsRed2 plasmid was replaced with a XbaI restriction enzyme recognition site. This was done by linearizing the plasmid by NotI enzymatic digestion, followed by blunt-ending using T4 polymerase. A XbaI adapter was then ligated with T4 DNA ligase onto the linearized plasmid and sticky ends were obtained through subsequent XbaI digestion. This modified plasmid was circularized by ligation with T4 DNA ligase. The resulting plasmid was then digested with BamHI, blunt-ended with T4 DNA polyermase and then digested with XbaI. Subsequently a 1.29 kb fragment containing the IRES2-DsRed2 sequence was gel purified. The pCS2-MT-Ngn1 plasmid was prepared for insertion of the IRES2-DsRed2 fragment by linearizing through XhoI digest, then blunt-ended with T4 DNA polymerase, followed by XbaI digestion, and then dephosphorylated using shrimp alkaline phosphatase. After gel purification this linearized plasmid was ligated with the blunt/sticky-ended IRES2-DsRed2 fragment to generate a pCS2-MT-6xMyc-mNeurog1-IRES2-DsRed2 plasmid.The next step involved the insertion of the 5 Atoh1 genomic fragment into the pCS2-MT-6xMyc-mNeurog1-IRES2-DsRed2 plasmid. A unique single EcoRV site was created in pCS2-MT-6xMyc-mNeurog1-IRES2-DsRed2 plasmid by partial DraI digestion to yield a linearized plasmid with only one of the four DraI sites (nucleotide positions 93, 3817, 3836 and 4528) being cut. EcoRV adapters were next ligated onto the ends of the linearized plasmids, followed by digested with EcoRV and then circularized by ligation. A clone containing an EcoRV site at position 93 was selected for further cloning steps. A linearized plasmid with sticky/blunt ends was produced by a double digestion using the ClaI and EcoRV restriction enzymes, which was then dephosphorylated with shrimp alkaline phosphatase. The ClaI site was immediately upstream of EcoRV site. The pMath1-5 -9 plasmid was initially digested with SphI and blunted with T4 DNA polymerase, which was then followed by complete digestion with ClaI to create ClaI sticky ends. The 5.07 kb fragment, which included 15 bps of the Atoh1 coding sequence, was ligated into pCS2-MT-6xMyc-mNeurog1-IRES2-DsRed2 linearized plasmid to create a pCS2-MT-5 Atoh1-6xMyc-mNeurog1-IRES2-DsRed2 plasmid.A plasmid, pBSII-loxP-pGKneo-3 Atoh1, was constructed that contained the floxed PKGneo cassette in reverse orientation to the 3 Atoh1 sequence. The pGKneo-II plasmid was partially digested with XbaI and blunted by T4 DNA polymerase treatment. The 4.77 kb linearized pGKneo-II plasmid was then digest with BamHI and treated with shrimp alkaline phosphatase. A 4.60 kb fragment containing the 3 Atoh1 sequence was generated by a partial digestion with KpnI to linearize the pApa4.2 fragment, which was then blunted by T4 DNA polymerase. This product was then digested with BamHI and the fragment was then gel purified, followed by ligation into the dephosphorylated linearized pGKneoII plasmid. The multilinker sequence in this construct was removed by partial digestion with SalI to yield a linearized plasmid and then digested with BamHI. The overhanging ends were blunted using T4 DNA ligase to generate the pBSII-loxP-PGKneo-3 Atoh1 plasmid.The final knockin (KI) construct was created by linearizing the pBSII-loxP-PGKneo-3 Atoh1 through digestion of the adjacent ClaI and EcoRV sites with both their respective enzymes to create a sticky/blunt linearized plasmid. This DNA was then dephosphorylated with shrimp alkaline phosphatase. A 7.63 kb fragment containing the 5 Atoh1-6XMyc-mNeurog1-IRES2-DsRed2 sequence was prepared for insert into the prepared pBSII-loxP-PGKneo-3 Atoh1 dephosphorylated plasmid. The pCS2-MT-5 Atoh1-6XMyc-mNeurog1-IRES2-DsRed2 plasmid was linearized by NotI digestion and then treated with T4 DNA polymerase to create blunt ends, followed by digestion with ClaI. The resulting 7.63 kb fragment was then ligated into the pBSII-loxP-PGKneo-3 Atoh1 to generate a pBSII-5 Atoh1-6XMyc-mNeurog1-IRES2-DsRed2- loxP-PKGneo-3 Atoh1 plasmid and was designated as pAtoh1KINeurog1. The Atoh1KINeurog1 sequence was then cloned into PGKdtabpA. The Atoh1KINeurog1 insert was prepared by digestion of pAtoh1KINeurog1 with ClaI followed by the blunting using T4 DNA polymerase and the desired fragment was excised with NotI digestion. This fragment was gel purified. The PGKdtabpA vector was prepared by partial SpeI digestion to linearize the plasmid, blunting with T4 DNA polymerase, followed by NotI digestion and then dephosphorylated by shrimp alkaline phosphatase. The Atoh1KINeurog1 sequence was then ligated with T4 DNA ligase into the gel purified linearized PGKdtabpA plasmid. The final pPGKdtabpA-Atoh1KINeurog1 plasmid was linearized by NotI digestion and gel purified. This fragment was used for transformation of the embryonic stem cells. All plasmid constructs were analyzed by restriction enzyme digestions and DNA sequence analyses of the ligated ends to confirm that the correct plasmids were generated. A complete sequence analysis of the Neurog1 insert was done to verify that no changes had occurred during the production of the pPGKdtabpA-Atoh1KINeurog1 plasmid.

Atoh1KINeurog1 production. Two 129/SvJ ES cell lines, E14 and R1, were used for targeting [PMID3821905, PMID8378314]. The linearized pGKdtabpa-KI construct was injected into ES cell lines. The number of ES cell DNA after positive (Neo) and negative (HSV thymidine kinase and Diphtheria toxin) selection protocols were a total of 273 (103 derived from E14 and 170 derived from R1 ES cell lines). Genomic DNA samples were isolated from each clone and EcoRI digestions were done to initially identify those clones with putative homologous recombination. The wild-type genomic DNA produced a restriction fragment length (RFL) of 13.3 kb for both the 5 and 3 genomic probes. The predicted genomic RFL were 5.2 kb and 9.7 kb that was detected by the 5 and 3 probes, respectively. We were able to identify 48 ES cultures with EcoRI fragments of 5.2, 9.7 and 13.3 kb. DNA samples from 40 of these positive ES clones underwent HindIII digestions. We were able to identify 15 clones that demonstrated the predicted RFLs of 5.4 kb 5 fragment and two 3 RFLs, 19.5 kb and 22 kb, that represented the wild-type (Atoh1+) and knockin (Atoh1KINeurog1; also referred to as Atoh1tm1Bfri) alleles, respectively. These ES cell lines were examined for their morphology and growth characteristics and five of those that demonstrated similar histological features to the original ES cell lines were selected for implantation into estrogen-primed female mice and was done by the University of Nebraska Medical Center Mouse Genome Engineering Facility using established procedures [PMID3821905, PMID8378314]. Only the offspring from the 8C1 culture demonstrated germ line transmission of the Atoh1KINeurog1 allele and thus produced the Atoh1KINeurog1 mouse line.

Southern blotting. Southern blotting was done as previously described with some modifications [PMID2574857]. Briefly, 5 g of genomic DNA from each ES cell culture line was digested overnight at 37 C using 15 U of restriction enzyme per g of genomic DNA. High fidelity EcoRI or HindIII enzymes (New England Biolabs, Ipswich, MA) were used. Digested DNAs were electrophoresed overnight on a 0.8% agarose gel. The gel was treated by soaking in a 0.25 N HCl solution, then the DNA was denatured using 0.5 M NaOH solution, followed by a 10X SSC solution (1.5 M NaCl/150 mM sodium citrate, pH 7.0) and then blotted onto Hybond-N+ filters (Amersham, Piscataway, NJ) using a vacuum blotter system (BioRad, Hercules, CA) following the manufacturer's instructions. Probes were amplified by two primer sets specific for genomic DNA up- and downstream of the mouse Atoh1 gene. 5 probe: gmAtoh1 5 -FOR (5 CTGAGGAATACCGAATGGCAGAG 3 ) and gmAtoh1 5 -REV (5 CTACTTCCCTAACCACCCATTCC 3 ) with an 1102 bp amplicon.3 probe: gmAtoh1 3 -FOR (5 CATGCTGACTGG TTCCTTTCTCTC 3 ) and gmAtoh1 3 -REV (5 GGTCTGGCTTCDTGTAAACTCTGC 3 ) that yielded 1195 bp product. Purified PCR amplicons were then random primer labeled using 6000 Ci/mml dCTP ( 32P) and dATP ( 32P) as per manufacturer's protocol (Roche Applied Science, Indianapolis, IN). Filters were hybridized overnight at 65 C [PMID2574857] and washed using high stringent conditions (0.1X SSC, 1% SDS) at 65 C. The filters were developed using a Storm Phosphorimager and the resulting images analyzed to determine the number and sizes of the detected RFLs.

Genotyping. Genotyping of Atoh1KINeurog1 mice was completed using tail DNA for standard PCR amplification. The PCR conditions consisted of an initial denaturing step at 94 C for 2 minutes, an amplification step for 32 cycles at 94 C for 30 seconds, 55 C for 30 seconds, and 72 C for 1 minute, and a final elongation step at 72 C for 10 minutes. EconoTaq plus green 2X master mix (Lucigen, 30033) and a three primer set were used for these reactions. All resultant products were electrophoresed and visualized on a 2% agarose gel. The three primer set consisted of KI-PKG-9225 (3 forward) with a sequence 5 -CTA CCC GCT TCC ATT GCT CAG C-3 , GT gmAtoh1-9179 (3 reverse) with a sequence of 5 -ACT CTC CGT CAC TTC TGT GGG ATC-3 , and Atoh1 S1 with a sequence of 5 -GAC CAC CAT CAC CTT CGC ACC-3 . The wild-type Atoh1 allele (Atoh1+) was determined by the primer set Atoh1 S1 and GT gm Atoh1-9179 and produced a 300 bp product. The KINeurog1 allele was detected with the primer set KI-PKG-9225 and GT gmAtoh1-9179 and produced a 600 bp product. Atoh1 conditional knockout (CKO, Pax2-cre; Atoh1 f/f) mice were generated by crossing the floxed Atoh1 with the Tg (Pax2-cre) line described previously [PMID10364557, PMID21146598].

In situ hybridization. In situ hybridization was performed using the RNA probe labeled with digoxigenin. The plasmids containing the cDNAs were used to generate the RNA probe by in vitro transcription. Locked nucleic acid (LNA) probes for microRNAs (miR-96 and miR-124) were purchased and used as described previously (miRCURY LNA probes; Exiqon, Woburn, MA; [PMID21360794]). Ntf3 antisense probe was made using the IMAGE clone 1177923 and EcoRI restriction enzymes and T3 RNA polymerase was used. After being anesthetized with Avertin, mice were perfused in 4% paraformaldehyde (PFA) and fixed overnight in 4% PFA. The ears were dissected in 0.4% PFA and dehydrated and rehydrated in graded methanol series and then digested briefly with 20 g/ml of Proteinase K (Ambion, Austin, TX, USA) for 15-20 minutes. Then the samples were hybridized overnight at 60 C to the riboprobe in hybridization solution containing 50% (v/v) formamide, 50% (v/v) 2X saline sodium citrate (Roche) and 6% (w/v) dextran sulphate. After washing off the unbound probe, the samples were incubated overnight with an anti-digoxigenin antibody (Roche Diagnostics GmbH, Mannheim, Germany) conjugated with alkaline phosphatase. After a series of washes, the samples were reacted with nitroblue phosphate/5-bromo, 4-chloro, 3-indolil phosphate (BM purple substrate, Roche Diagnostics, Germany) which is enzymatically converted to a purple colored product. The ears were mounted flat in glycerol and viewed in a Nikon Eclipse 800 microscope using differential interference contrast microscopy and images were captured with Metamorph software. The ears of the littermate of different genotype for the same gene expression were performed in the same reaction tubes to maintain the reaction accuracy.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

No mating problems were encountered

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
brown/black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
Homozygotic Atoh1 kiNeurog1 are not viable. We maintain lines that are randomly crossed to generate Atoh1-cre; Atoh1 f/kiNeurog1 mutants for our research.
Generation
1
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: No No
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
5-9
Recommended wean age
3-4 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043528-MU-RESUS Litter recovered from cryo-archive $2,624.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.