Strain Name:
Stock Number:
Citation ID:
Major Collection:

Gene Information

Allele Symbol: Ppfia3em1(IMPC)J (Mus musculus (mouse))
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3; endonuclease-mediated mutation 1, Jackson
Alteration at locus: Targeted Mutation
Monarch Initiative (Disease and Phenotype Associations): MGI:6109981
Gene Symbol: Ppfia3 (Mus musculus (mouse))
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms: Liprin-alpha3, 2410127E16Rik
Chromosome: 7
Alteration at locus: Targeted Mutation
Monarch Initiative (Disease and Phenotype Associations): MGI:1924037
Genetic Alterations
intragenic deletion
ES Cell Line
MeSH Terms
    Strain Development
    This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGCCACAGACAGAAAGGGC, GGAGCTTGCCACAGACAGAA, GATGAGGGATGGGTTAAGGA and GTTGAGTGAGACATGAAGGG, which resulted in a 824 bp deletion beginning at Chromosome 7 negative strand position 45,355,486 bp and ending after 45,354,663 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273174, ENSMUSE1236795, ENSMUSE00001284496 (exons 11-13) and 549 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 415 and early truncation 44 amino acids later.
    Suggested Control Mice
    C57BL/6NJ or wild-type from colony
    Stephen Murray, Ph.D., The Jackson Laboratory.

    Colony and Husbandry Informationon

    For more information about this colony's health status contact
    Coat Color
    Overall Breeding Performance
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Undetermined Undetermined Undetermined
    Homozygotes are fertile: Undetermined Undetermined Undetermined
    Heterozygotes are fertile: Undetermined Undetermined Undetermined
    Age Reproductive Decline: Undetermined Undetermined
    Average litter size
    Average Pups Weaned

    Order Request Information

    Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at for more details.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
    Heterozygous / Hemizygous Female
    Heterozygous / Hemizygous Male
    Wild Type Female
    Wild Type Male
    $218.00 / $218.00
    Non-Profit / For-Profit
    Per Mouse The may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).

    1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.