Strain Name:
C57BL/6NJ-Srek1em1(IMPC)J/Mmjax
Stock Number:
043730-JAX
Citation ID:
RRID:MMRRC_043730-JAX
Major Collection:

Gene Information

Allele Symbol: Srek1em1(IMPC)J (Mus musculus (mouse))
Name: splicing regulatory glutamine/lysine-rich protein 1; endonuclease-mediated mutation 1, Jackson
Alteration at locus: Targeted Mutation
Monarch Initiative (Disease and Phenotype Associations): MGI:6112028
Gene Symbol: Srek1 (Mus musculus (mouse))
Name: splicing regulatory glutamine/lysine-rich protein 1
Synonyms: AL118220, SRrp508, SRrp86, Sfrs12
Chromosome: 13
Alteration at locus: Targeted Mutation
Monarch Initiative (Disease and Phenotype Associations): MGI:2145245
Genetic Alterations
intragenic deletion
ES Cell Line
N/A
MeSH Terms
    Strain Development
    This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCCTGTACAACAACACTG, GTGTTTCTGCGAGGCTAGAA, AGTAGTGCTCTATTTAGTTG and AGATCAGTCATCACTTTCTA, which resulted in a 384 bp deletion beginning at Chromosome 13 negative strand position 103,759,538 bp and ending after 103,759,155 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314888 (exon 4) and 253 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 139 and early truncation 4 amino acids later.
    Suggested Control Mice
    C57BL/6NJ or wild-type from colony
    Donor
    Stephen Murray, Ph.D., The Jackson Laboratory.

    Colony and Husbandry Informationon

    https://www.jax.org/~/media/jaxweb/health-reports/ax9.pdf?la=en

    For more information about this colony's health status contact csmmrrc@jax.org
    Coat Color
    black
    Generation
    N2F2
    Overall Breeding Performance
    Undetermined
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Undetermined Undetermined Undetermined
    Homozygotes are fertile: Undetermined Undetermined Undetermined
    Heterozygotes are fertile: Undetermined Undetermined Undetermined
    Age Reproductive Decline: Undetermined Undetermined
    Average litter size
    Undetermined
    Average Pups Weaned
    Undetermined

    Order Request Information

    Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
    043730-JAX-HET-F
    043730-JAX-HET-M
    043730-JAX-WT-F
    043730-JAX-WT-M
    Heterozygous / Hemizygous Female
    Heterozygous / Hemizygous Male
    Wild Type Female
    Wild Type Male
    $218.00 / $218.00
    Non-Profit / For-Profit
    Per Mouse The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).

    1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.