Strain Name:
STOCK Prokr2em1(icre)Cfe/Mmjax
Stock Number:
043846-JAX
Citation ID:
RRID:MMRRC_043846-JAX
Other Names:
ProkR2-Cre, PR2-Cre

Strain Information

Prokr2em1(icre)Cfe
Name: prokineticin receptor 2; endonuclease-mediated mutation 1, Carol F Elias
Synonyms: Prokr2-Cre
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: CRISPR
Prokr2
Name: prokineticin receptor 2
Synonyms: Gpr73l1, EG-VEGRF2, Gpcr73l1, PKR2, B830005M06Rik
Type: Gene
Species: Mouse
Chromosome: 2
Alteration at locus: CRISPR
NCBI: 246313
Homologene: 16368
icre
Name: codon-improved cre recombinase sequence
Type: Gene
Species: Enterobacteria phage P1 (bacteriophage P1)
Chromosome:
Alteration at locus: CRISPR
Genetic Alterations
Between the final Prokr2 codon and termination codon, a GSG linker, a T2A viral peptide, an iCre recombinase, and a bovine growth hormone polyadenylation signal (bPA) were inserted (Goodwin and Rottman 1992; Kim et al. 2011; Shimshek et al. 2002) using CRISPR/Cas9 technology.
Genotype Determination
Phenotype

Homozygous: No changes in GnRH migration, olfactory bulb development, reproductive function, and body weight have been observed in homozygous mice.

Hetero/Hemizygous: No changes in GnRH migration, olfactory bulb development, reproductive function, and body weight have been observed in heterozygous/hemizygous mice.

Image

MeSH Terms
  • Animals
  • Brain/pathology
  • Disease Models, Animal
  • Estrogen Receptor alpha/metabolism
  • Female
  • Gene Expression Regulation/genetics
  • Gonadotropin-Releasing Hormone/metabolism
  • Green Fluorescent Proteins/genetics
  • Green Fluorescent Proteins/metabolism
  • Integrases
  • Kallmann Syndrome/genetics
  • Kallmann Syndrome/pathology
  • Male
  • Mice
  • Mice, Inbred C57BL
  • Mice, Transgenic
  • Neurons/metabolism
  • RNA, Messenger/metabolism
  • Receptors, G-Protein-Coupled/genetics
  • Receptors, G-Protein-Coupled/metabolism
  • Receptors, Peptide/genetics
  • Receptors, Peptide/metabolism
  • Sex Characteristics
Strain Development

Detailed description as published in Mohsen et al., 2017:

We used the Clustered Regularly Interspaced Short Palindromic Repeats associated protein Cas9 (CRISPR/Cas9) technology (Cong et al. 2013Mali et al. 2013) to generate a transgenic mouse line that expresses Cre recombinase in Prokr2-expressing cells. A single guide RNA (sgRNA) target and protospacer adjacent motif was identified on the coding strand: 5’ CCTCGACCTCAAAACCAGCG GGG3 3’ with a predicted cut site 44 bp upstream of the termination codon. The sgRNA target is located at mouse chromosome 2, nucleotides 132373439-132373459 (NCBI Reference Sequence: NC_000068.7). The activity of sgRNA/Cas9 complex at the target was demonstrated by analysis of genomic DNA extracted from blastocysts that developed in in vitro culture from mouse zygotes that had been microinjected with Cas9 reagents, as described (Sakurai et al. 2014). DNA sequence analysis of PCR products obtained by amplification across the Cas9 target showed the presence of insertions/deletions (indels) in the genomic DNA due to non-homologous end joining repair of double-strand chromosome breaks induced by sgRNA/Cas9 complexes. After the demonstration of effective Cas9 cleavage of the target, a donor plasmid for homology directed repair was synthesized that included 800 bp of sequence upstream of the sgRNA target. Multiple silent coding changes were introduced in the Cas9 target to block Cas9 re-cleavage after correct repair of chromosome breaks by the donor DNA: 5’ CCTCGACtTaAAgACatctG GcG 3’. Between the final Prokr2 codon and termination codon a GSG linker, a T2A viral peptide, an iCre recombinase, and a bovine growth hormone polyadenylation signal (bPA) were inserted (Goodwin and Rottman 1992Kim et al. 2011Shimshek et al. 2002). Immediately downstream of the bPA was the endogenous Prokr2 termination codon and 797 bp of genomic sequence that comprised the 800 bp 3’ arm of homology. The sgRNA target was cloned into the plasmid pX330 (Addgene.org plasmid #42230, a kind gift of Feng Zhang) as described (Ran et al. 2013). The circular pX330 plasmid (5 ng/uL final concentration) (Mashiko et al. 2013) and circular donor plasmid (10 ng/uL final concentration) were mixed together for microinjection. Fertilized eggs were produced by mating superovulated B6SJLF1 with B6SJLF1 males (JAX Strain #100012). Pronuclear microinjection was carried out as described (Becker and Jechow 2011Van Keuren et al. 2009). A total of 293 zygotes were microinjected, 255 surviving zygotes were transferred to B6D2F1 (JAX Strain #100006) pseudopregnant female mice and 85 pups were born. Genotyping of genomic DNA extracted from tail tip biopsies was performed by PCR with primers internal to and external to the DNA donor plasmid, and confirmed by DNA sequencing analysis. Single copy integration was confirmed by PCR. Two primers pairs were used. The 5’ pair included a primer outside the 5’ arm of homology and one inside Cre recombinase. The 3’ pair included a primer outside the 3’ arm of homology and one inside Cre recombinase. Following identification of Prokr2-Cre founders, quantitative PCR of genomic iCre was performed to determine the integration events in heterozygous and homozygous mice. Interleukin 2 (Il2 gene) was used as a random control for positive homozygosity.
Suggested Control Mice
Wild-type littermates
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
  • Developmental Biology
  • Endocrine Deficiency
  • Models for Human Disease
  • Reproduction
  • Sensorineural
Donor
Carol F. Elias, Ph.D., University of Michigan.
Primary Reference

Mohsen Z, Sim H, Garcia-Galiano D, Han X, Bellefontaine N, Saunders TL, Elias CF. Sexually dimorphic distribution of Prokr2 neurons revealed by the Prokr2-Cre mouse model. Brain Struct Funct. 2017 Dec;222(9):4111-4129. doi:10.1007/s00429-017-1456-5. Epub 2017 Jun 14. (Medline PMID: 28616754)

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Generation
F7-8
Overall Breeding Performance
Excellent
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
No
Average litter size
5-9
Recommended wean age
3 weeks
Average Pups Weaned
5-9

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043846-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
043846-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / $2,022.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.