Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5914Btlr
Stock Number:
044111-MU
Citation ID:
RRID:MMRRC_044111-MU
Other Names:
R5914 (G1)
Major Collection:

Strain Information

Cnnm2
Name: cyclin M2
Synonyms: Acdp2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 94219
VEGA: 19
HGNC: HGNC:103
Homologene: 9761
Fzd9
Name: frizzled class receptor 9
Synonyms: mfz9, frizzled 9, Fz9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14371
HGNC: HGNC:4047
Homologene: 2619
Ubp1
Name: upstream binding protein 1
Synonyms: NF2d9, LBP-1b, LBP-1a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22221
VEGA: 9
Homologene: 8435
Gnl3
Name: guanine nucleotide binding protein nucleolar 3
Synonyms: nucleostemin, NS
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30877
VEGA: 14
Homologene: 56670
Ctdspl2
Name: CTD small phosphatase like 2
Synonyms: D2Ertd485e, SCP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329506
Homologene: 32311
Cep97
Name: centrosomal protein 97
Synonyms: 4932439K18Rik, E130116N02Rik, 2810403B08Rik, Lrriq2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74201
Homologene: 11579
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 83,061,323 bp
  • T to C, chromosome 1 at 84,763,458 bp
  • T to A, chromosome 1 at 90,776,200 bp
  • T to A, chromosome 1 at 94,040,825 bp
  • T to C, chromosome 1 at 107,451,850 bp
  • C to A, chromosome 1 at 130,700,095 bp
  • A to T, chromosome 1 at 140,136,229 bp
  • A to T, chromosome 1 at 165,351,155 bp
  • G to A, chromosome 1 at 171,282,171 bp
  • G to T, chromosome 2 at 5,798,363 bp
  • T to C, chromosome 2 at 44,997,052 bp
  • T to C, chromosome 2 at 76,951,312 bp
  • T to C, chromosome 2 at 90,453,340 bp
  • C to G, chromosome 2 at 90,774,793 bp
  • T to A, chromosome 2 at 109,918,272 bp
  • G to A, chromosome 2 at 119,458,216 bp
  • A to T, chromosome 2 at 121,978,933 bp
  • T to A, chromosome 2 at 160,909,070 bp
  • T to C, chromosome 2 at 164,393,224 bp
  • C to T, chromosome 3 at 54,373,800 bp
  • T to C, chromosome 3 at 88,635,869 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • T to A, chromosome 3 at 127,561,023 bp
  • T to A, chromosome 4 at 62,327,810 bp
  • T to C, chromosome 4 at 83,001,775 bp
  • T to C, chromosome 4 at 129,672,692 bp
  • G to T, chromosome 4 at 136,241,409 bp
  • C to A, chromosome 4 at 150,629,540 bp
  • A to T, chromosome 5 at 24,592,423 bp
  • C to T, chromosome 5 at 101,663,981 bp
  • G to A, chromosome 5 at 102,552,159 bp
  • A to G, chromosome 5 at 115,610,135 bp
  • T to C, chromosome 5 at 135,249,345 bp
  • C to T, chromosome 6 at 14,718,989 bp
  • T to A, chromosome 6 at 21,968,905 bp
  • C to T, chromosome 6 at 82,736,634 bp
  • A to T, chromosome 6 at 118,080,554 bp
  • A to T, chromosome 6 at 125,134,728 bp
  • G to T, chromosome 6 at 139,622,479 bp
  • T to A, chromosome 7 at 3,672,009 bp
  • T to A, chromosome 7 at 5,610,530 bp
  • A to G, chromosome 7 at 33,165,266 bp
  • A to T, chromosome 7 at 85,151,836 bp
  • A to T, chromosome 7 at 104,357,365 bp
  • G to A, chromosome 7 at 114,030,821 bp
  • T to C, chromosome 7 at 140,129,188 bp
  • C to T, chromosome 8 at 39,581,827 bp
  • T to G, chromosome 8 at 46,181,858 bp
  • T to C, chromosome 8 at 70,075,563 bp
  • T to A, chromosome 8 at 71,474,650 bp
  • A to C, chromosome 9 at 7,857,342 bp
  • G to T, chromosome 9 at 14,811,936 bp
  • G to C, chromosome 9 at 38,488,361 bp
  • T to C, chromosome 9 at 38,741,742 bp
  • G to A, chromosome 9 at 44,711,651 bp
  • T to C, chromosome 9 at 50,698,588 bp
  • G to A, chromosome 9 at 110,385,443 bp
  • A to T, chromosome 9 at 113,956,739 bp
  • A to C, chromosome 10 at 20,104,255 bp
  • A to T, chromosome 10 at 69,992,944 bp
  • T to C, chromosome 10 at 74,630,936 bp
  • A to G, chromosome 11 at 4,920,416 bp
  • G to A, chromosome 11 at 11,154,244 bp
  • T to C, chromosome 11 at 60,187,804 bp
  • C to T, chromosome 11 at 69,458,920 bp
  • T to A, chromosome 11 at 86,222,174 bp
  • A to T, chromosome 11 at 105,385,482 bp
  • T to A, chromosome 12 at 44,295,970 bp
  • T to G, chromosome 12 at 101,760,743 bp
  • T to A, chromosome 12 at 102,234,790 bp
  • A to G, chromosome 13 at 70,606,377 bp
  • C to A, chromosome 14 at 31,016,896 bp
  • T to C, chromosome 14 at 61,611,831 bp
  • G to A, chromosome 15 at 74,538,370 bp
  • T to C, chromosome 15 at 89,145,835 bp
  • T to C, chromosome 16 at 55,905,457 bp
  • C to T, chromosome 17 at 31,531,232 bp
  • C to T, chromosome 17 at 80,547,691 bp
  • C to A, chromosome 17 at 88,462,710 bp
  • T to A, chromosome 18 at 77,959,632 bp
  • A to G, chromosome 19 at 13,410,962 bp
  • A to G, chromosome 19 at 46,763,177 bp
  • G to A, chromosome 19 at 55,898,560 bp
  • A to T, chromosome 19 at 60,221,093 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5914 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044111-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.