Strain Name:
Stock Number:
Citation ID:
Other Names:
R5914 (G1)
Major Collection:

Gene Information

Name: cyclin M2
Synonyms: Acdp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 94219
VEGA: 19
Homologene: 9761
Name: frizzled class receptor 9
Synonyms: mfz9, frizzled 9, Fz9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14371
Homologene: 2619
Name: upstream binding protein 1
Synonyms: NF2d9, LBP-1b, LBP-1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22221
Homologene: 8435
Name: guanine nucleotide binding protein-like 3 (nucleolar)
Synonyms: nucleostemin, NS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 30877
VEGA: 14
Homologene: 56670
Name: CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
Synonyms: D2Ertd485e, SCP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329506
Homologene: 32311
Name: centrosomal protein 97
Synonyms: 4932439K18Rik, E130116N02Rik, 2810403B08Rik, Lrriq2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74201
Homologene: 11579
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231659
Homologene: 5887
Name: transcription factor 7 like 2, T cell specific, HMG box
Synonyms: TCF4E, TCF4B, mTcf-4E, mTcf-4B, Tcf-4, Tcf4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 21416
Homologene: 7564
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 104831
Homologene: 135706
Name: formin binding protein 4
Synonyms: FBP30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 55935
Homologene: 9087
Name: karyopherin (importin) alpha 6
Synonyms: IPOA7, NPI-2, importin alpha 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16650
Homologene: 22472
Name: forkhead box N2
Synonyms: HTLF, Fkh19, 6030465J18Rik, 3230402J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14236
Homologene: 31078
Name: thyroid hormone receptor interactor 12
Synonyms: Gtl6, 1110036I07Rik, 6720416K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14897
Homologene: 44226
Name: leucine-rich repeat-containing G protein-coupled receptor 4
Synonyms: A930009A08Rik, Gpr48, A330106J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 107515
Homologene: 10226
Name: zinc finger, GRF-type containing 1
Synonyms: 4930422G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71643
Homologene: 34708
Name: FK506 binding protein 15
Synonyms: FKBP133, C430014M02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 338355
Homologene: 28743
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11735
Homologene: 56908
Name: macrophage scavenger receptor 1
Synonyms: SR-AII, SR-AI, MSR-A, Scara1, Scvr, MRS-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20288
Homologene: 12822
Name: hexokinase 2
Synonyms: HKII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 15277
Homologene: 37273
Name: pleckstrin homology like domain, family B, member 1
Synonyms: LL5A, D330037A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102693
Homologene: 15903
Name: family with sequence similarity 204, member A
Synonyms: 2610015K05Rik, 2310065H12Rik, D19Ertd737e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 76539
VEGA: 19
Homologene: 41463
Name: inhibitor of growth family, member 3
Synonyms: P47ING3, 1300013A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71777
Homologene: 6804
Name: protein tyrosine phosphatase, receptor type, J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19271
Homologene: 2130
Name: Fras1 related extracellular matrix protein 1
Synonyms: eyem02Jus, heb, QBRICK, eyes2, crf11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329872
Homologene: 27049
Name: ectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms: 5430411K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 100502841
VEGA: 18
Homologene: 14575
Name: von Willebrand factor C domain containing 2
Synonyms: A930041G11Rik, Brorin, cradin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 319922
Homologene: 18542
Name: chondroitin polymerizing factor 2
Synonyms: 2010209O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100910
Homologene: 14763
Name: rho/rac guanine nucleotide exchange factor (GEF) 2
Synonyms: Lfc, GEF-H1, LFP40, GEFH1, P40, Lbcl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 16800
Homologene: 3468
Name: NOP2 nucleolar protein
Synonyms: 120kDa, Nol1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 110109
Homologene: 135865
Name: DET1 and DDB1 associated 1
Synonyms: 1700095J19Rik, 1500034J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66498
Homologene: 11436
Name: cilia and flagella associated protein 97
Synonyms: 1110068E21Rik, 4933411K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66756
Homologene: 12026
Name: INO80 complex subunit
Synonyms: 2310079N15Rik, INO80, 4632409L19Rik, Inoc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68142
Homologene: 75070
Name: integrator complex subunit 2
Synonyms: 2810417D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70422
Homologene: 10801
Name: DDB1 and CUL4 associated factor 6
Synonyms: PC326, 1200006M05Rik, Iqwd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74106
Homologene: 10199
Name: cell division cycle 123
Synonyms: G431001I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98828
Homologene: 4394
Name: interactor of little elongation complex ELL subunit 1
Synonyms: BC018507
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218333
VEGA: 13
Homologene: 18902
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Synonyms: UPLC1, 9430088F20Rik, Ddefl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230837
Homologene: 41190
Name: retinoic acid induced 1
Synonyms: Gt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19377
Homologene: 7508
Name: NK6 homeobox 1
Synonyms: NKX6A, Nkx6.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18096
Homologene: 4495
Name: programmed cell death 1
Synonyms: PD-1, Pdc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18566
Homologene: 3681
Name: mitogen-activated protein kinase 11
Synonyms: Prkm11, p38beta, Sapk2, P38b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 19094
VEGA: 15
Homologene: 55684
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
Homologene: 72110
Name: mitogen-activated protein kinase kinase kinase 5
Synonyms: ASK1, Mekk5, 7420452D20Rik, ASK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 26408
Homologene: 38114
Name: protein phosphatase 1, regulatory subunit 3A
Synonyms: GM, RGL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 140491
Homologene: 48124
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18705
Homologene: 3362
Name: solute carrier family 45, member 1
Synonyms: Dnb5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242773
Homologene: 44908
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12835
Homologene: 37917
Name: cyclin-dependent kinase-like 4
Synonyms: LOC381113
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 381113
VEGA: 17
Homologene: 28725
Name: MRE11A homolog A, double strand break repair nuclease
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17535
Homologene: 4083
Name: patatin-like phospholipase domain containing 8
Synonyms: 1200006O19Rik, iPLA2 gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 67452
Homologene: 12136
Name: tripartite motif-containing 30B
Synonyms: Trim30-1, A530023O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244183
Name: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms: PFK-2/FBPase-2 gene B, 4930568D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18640
Homologene: 88554
Name: polyamine oxidase (exo-N4-amino)
Synonyms: Pao, 2410012F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 212503
Homologene: 72096
Name: periostin, osteoblast specific factor
Synonyms: OSF-2, Periostin, Osf2, peri, A630052E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 50706
Homologene: 4730
Name: von Willebrand factor A domain containing 5A
Synonyms: BCSC-1, 5830475I06Rik, Loh11cr2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67776
Homologene: 18222
Name: transmembrane 6 superfamily member 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 107770
Homologene: 77694
Name: vomeronasal 1 receptor 61
Synonyms: Gm7186
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 636731
Homologene: 41799
Name: adhesion G protein-coupled receptor B1
Synonyms: B830018M07Rik, Bai1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 107831
Homologene: 1287
Name: membrane associated ring-CH-type finger 10
Synonyms: 4933417C16Rik, Rnf190, OTTMUSG00000002847, March10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 632687
Homologene: 34988
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 4
Synonyms: NCKX4, A930002M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238384
Homologene: 17798
Name: DIX domain containing 1
Synonyms: 4930563F16Rik, Ccd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 330938
Homologene: 82369
Name: transmembrane channel-like gene family 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 353499
Homologene: 16971
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
Homologene: 20086
Name: fibulin 5
Synonyms: EVEC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 23876
VEGA: 12
Homologene: 38170
Name: elastin microfibril interfacer 3
Synonyms: Emilin5, 1110013O17Rik, EMILIN-T
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 280635
Homologene: 18817
Name: THO complex 5
Synonyms: PK1.3, 1700060C24Rik, Fmip, A430085L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 107829
Homologene: 37836
Name: serine (or cysteine) peptidase inhibitor, clade B, member 7
Synonyms: megsin, 4631416M05Rik, ovalbumin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116872
Homologene: 68363
Name: baculoviral IAP repeat-containing 3
Synonyms: MIAP2, IAP2, Api2, cIAP2, cIAP-2, HIAP2, MIHC, RNF49
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11796
Homologene: 899
Name: Rho GTPase activating protein 24
Synonyms: 0610025G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231532
Homologene: 32754
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 620672
Homologene: 115466
Name: spondin 1, (f-spondin) extracellular matrix protein
Synonyms: D330035F22Rik, FSP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233744
Homologene: 4453
Name: ubiquitin specific peptidase 21
Synonyms: Usp16, ESTM28, Usp23, W53272
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 30941
Homologene: 56572
Name: zinc finger E-box binding homeobox 2
Synonyms: SIP1, Zfx1b, 9130203F04Rik, D130016B08Rik, Zfhx1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 24136
Homologene: 8868
Name: olfactory receptor 1469
Synonyms: GA_x6K02T2RE5P-3743369-3744289, MOR202-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258690
Homologene: 133675
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HAX-1, Silg111, Hs1bp1, HS1-associated protein X-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23897
Homologene: 4463
Name: olfactory receptor 906
Synonyms: GA_x6K02T2PVTD-32194085-32195020, MOR167-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258799
Homologene: 132439
Name: potassium channel regulator
Synonyms: LOC328424, E030012H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 328424
VEGA: 14
Homologene: 35259
Name: NADH:ubiquinone oxidoreductase core subunit V3
Synonyms: 1500032D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78330
Homologene: 10885
Name: RasGEF domain family, member 1A
Synonyms: 6330404M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70727
Homologene: 17067
Name: matrilin 4
Synonyms: matrilin-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17183
Homologene: 2844
Name: predicted gene 6003
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 102637838
Homologene: 141213
Name: keratin associated protein 28-13
Synonyms: 5530401N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71386
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 83,061,323 bp
  • T to C, chromosome 1 at 84,763,458 bp
  • T to A, chromosome 1 at 90,776,200 bp
  • T to A, chromosome 1 at 94,040,825 bp
  • T to C, chromosome 1 at 107,451,850 bp
  • C to A, chromosome 1 at 130,700,095 bp
  • A to T, chromosome 1 at 140,136,229 bp
  • A to T, chromosome 1 at 165,351,155 bp
  • G to A, chromosome 1 at 171,282,171 bp
  • G to T, chromosome 2 at 5,798,363 bp
  • T to C, chromosome 2 at 44,997,052 bp
  • T to C, chromosome 2 at 76,951,312 bp
  • T to C, chromosome 2 at 90,453,340 bp
  • C to G, chromosome 2 at 90,774,793 bp
  • T to A, chromosome 2 at 109,918,272 bp
  • G to A, chromosome 2 at 119,458,216 bp
  • A to T, chromosome 2 at 121,978,933 bp
  • T to A, chromosome 2 at 160,909,070 bp
  • T to C, chromosome 2 at 164,393,224 bp
  • C to T, chromosome 3 at 54,373,800 bp
  • T to C, chromosome 3 at 88,635,869 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • T to A, chromosome 3 at 127,561,023 bp
  • T to A, chromosome 4 at 62,327,810 bp
  • T to C, chromosome 4 at 83,001,775 bp
  • T to C, chromosome 4 at 129,672,692 bp
  • G to T, chromosome 4 at 136,241,409 bp
  • C to A, chromosome 4 at 150,629,540 bp
  • A to T, chromosome 5 at 24,592,423 bp
  • C to T, chromosome 5 at 101,663,981 bp
  • G to A, chromosome 5 at 102,552,159 bp
  • A to G, chromosome 5 at 115,610,135 bp
  • T to C, chromosome 5 at 135,249,345 bp
  • C to T, chromosome 6 at 14,718,989 bp
  • T to A, chromosome 6 at 21,968,905 bp
  • C to T, chromosome 6 at 82,736,634 bp
  • A to T, chromosome 6 at 118,080,554 bp
  • A to T, chromosome 6 at 125,134,728 bp
  • G to T, chromosome 6 at 139,622,479 bp
  • T to A, chromosome 7 at 3,672,009 bp
  • T to A, chromosome 7 at 5,610,530 bp
  • A to G, chromosome 7 at 33,165,266 bp
  • A to T, chromosome 7 at 85,151,836 bp
  • A to T, chromosome 7 at 104,357,365 bp
  • G to A, chromosome 7 at 114,030,821 bp
  • T to C, chromosome 7 at 140,129,188 bp
  • C to T, chromosome 8 at 39,581,827 bp
  • T to G, chromosome 8 at 46,181,858 bp
  • T to C, chromosome 8 at 70,075,563 bp
  • T to A, chromosome 8 at 71,474,650 bp
  • A to C, chromosome 9 at 7,857,342 bp
  • G to T, chromosome 9 at 14,811,936 bp
  • G to C, chromosome 9 at 38,488,361 bp
  • T to C, chromosome 9 at 38,741,742 bp
  • G to A, chromosome 9 at 44,711,651 bp
  • T to C, chromosome 9 at 50,698,588 bp
  • G to A, chromosome 9 at 110,385,443 bp
  • A to T, chromosome 9 at 113,956,739 bp
  • A to C, chromosome 10 at 20,104,255 bp
  • A to T, chromosome 10 at 69,992,944 bp
  • T to C, chromosome 10 at 74,630,936 bp
  • A to G, chromosome 11 at 4,920,416 bp
  • G to A, chromosome 11 at 11,154,244 bp
  • T to C, chromosome 11 at 60,187,804 bp
  • C to T, chromosome 11 at 69,458,920 bp
  • T to A, chromosome 11 at 86,222,174 bp
  • A to T, chromosome 11 at 105,385,482 bp
  • T to A, chromosome 12 at 44,295,970 bp
  • T to G, chromosome 12 at 101,760,743 bp
  • T to A, chromosome 12 at 102,234,790 bp
  • A to G, chromosome 13 at 70,606,377 bp
  • C to A, chromosome 14 at 31,016,896 bp
  • T to C, chromosome 14 at 61,611,831 bp
  • G to A, chromosome 15 at 74,538,370 bp
  • T to C, chromosome 15 at 89,145,835 bp
  • T to C, chromosome 16 at 55,905,457 bp
  • C to T, chromosome 17 at 31,531,232 bp
  • C to T, chromosome 17 at 80,547,691 bp
  • C to A, chromosome 17 at 88,462,710 bp
  • T to A, chromosome 18 at 77,959,632 bp
  • A to G, chromosome 19 at 13,410,962 bp
  • A to G, chromosome 19 at 46,763,177 bp
  • G to A, chromosome 19 at 55,898,560 bp
  • A to T, chromosome 19 at 60,221,093 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5914 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
044111-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.