Strain Name:
Stock Number:
Citation ID:
Other Names:
R5938 (G1)
Major Collection:

Strain Information

Name: apoptosis antagonizing transcription factor
Synonyms: 4933415H02Rik, Trb, 5830465M17Rik, Che-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56321
Homologene: 40811
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 70673
Homologene: 11139
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108096
Homologene: 56603
Name: serine and arginine-rich splicing factor 11
Synonyms: 0610009J05Rik, 2610019N13Rik, Sfrs11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69207
Homologene: 36164
Name: ubiquitin-like modifier activating enzyme 2
Synonyms: Sumo-1 activating enzyme subunit 2, UBA2, anthracycline-associated resistance, Arx, SAE2, Uble1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 50995
Homologene: 4018
Name: proline, glutamic acid and leucine rich protein 1
Synonyms: 4930563C04Rik, MNAR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 75273
Homologene: 8664
Name: staphylococcal nuclease and tudor domain containing 1
Synonyms: p100 co-activator, Tudor-SN
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56463
Homologene: 8665
Name: non-SMC condensin II complex, subunit G2
Synonyms: Mtb, 5830426I05Rik, Luzp5, mCAP-G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Name: erythrocyte membrane protein band 4.1 like 3
Synonyms: NBL3, 4.1B, DAL1P, Epb4.1l3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13823
Homologene: 49308
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233532
Homologene: 41142
Name: golgi-specific brefeldin A-resistance factor 1
Synonyms: 1700083E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107338
Homologene: 37897
Name: estrogen receptor 1 (alpha)
Synonyms: ESR, ERalpha, ER[a], Nr3a1, ERa, Estr, Estra, ER-alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13982
Homologene: 47906
Name: RAS p21 protein activator 2
Synonyms: GAP1m, 5430433H21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 114713
Homologene: 4745
Name: mannoside acetylglucosaminyltransferase 4, isoenzyme A
Synonyms: GnT-IVa, 9530018I07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269181
Homologene: 8153
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243743
Homologene: 77587
Name: MINDY lysine 48 deubiquitinase 1
Synonyms: cI-40, 1810005H09Rik, NF-E2 inducible protein, 4930504E06Rik, Fam63a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 75007
Homologene: 32409
Name: multiple PDZ domain crumbs cell polarity complex component
Synonyms: MUPP1, B930003D11Rik, multiple PDZ domain protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17475
Homologene: 2841
Name: peroxisome proliferative activated receptor, gamma, coactivator-related 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226169
Homologene: 9006
Name: ER membrane protein complex subunit 1
Synonyms: C230096C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230866
Homologene: 9002
Name: solute carrier family 29 (nucleoside transporters), member 3
Synonyms: Ent3, 4933435C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 71279
Homologene: 56805
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20190
Homologene: 68069
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80892
Homologene: 23477
Name: interaction protein for cytohesin exchange factors 1
Synonyms: A130090K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 320495
Homologene: 32271
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329628
Homologene: 14377
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12289
VEGA: 14
Homologene: 578
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12217
Homologene: 31161
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 268527
Homologene: 8780
Name: taste receptor, type 2, member 110
Synonyms: mt2r57, T2R10, Tas2r10, STC 9-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387344
Homologene: 130069
Name: erb-b2 receptor tyrosine kinase 2
Synonyms: Neu, Neu oncogene, c-erbB2, HER-2, ErbB-2, HER2, c-neu, l11Jus8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13866
Homologene: 3273
Name: thioredoxin-related transmembrane protein 3
Synonyms: 6430411B10Rik, A730024F05Rik, Txndc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67988
VEGA: 18
Homologene: 10381
Name: ring finger protein 207
Synonyms: D330010C22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433809
Homologene: 19234
Name: centrosomal protein 44
Synonyms: 4933440G23Rik, BC088983
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382010
Homologene: 12738
Name: olfactory receptor family 2 subfamily Q member 1
Synonyms: GA_x6K02T2P3E9-4742413-4741481, MOR257-3, Olfr450
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258437
Homologene: 51720
Name: olfactory receptor family 5 subfamily AK member 20
Synonyms: GA_x6K02T2Q125-46830591-46829662, MOR203-5P, Olfr988
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258166
Homologene: 103791
Name: chemokine (C-X-C motif) ligand 15
Synonyms: weche, lungkine, Scyb15, Il8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20309
Name: MHC I like leukocyte 1
Synonyms: 5530400I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 266815
Homologene: 105329
Name: predicted gene 4951
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240327
Name: 2'-5' oligoadenylate synthetase 1C
Synonyms: Oasl5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 114643
Homologene: 110815
Name: olfactory receptor family 4 subfamily K member 49
Synonyms: GA_x6K02T2Q125-72715642-72716580, MOR248-8, Olfr1299
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258886
Homologene: 17426
Name: N-sulfoglucosamine sulfohydrolase (sulfamidase)
Synonyms: sulphamidase, 4632406A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 27029
Homologene: 167
Name: WAP, FS, Ig, KU, and NTR-containing protein 1
Synonyms: Gasp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 215001
Homologene: 14244
Name: Rh blood group, D antigen
Synonyms: Rh, Rhl1, Rhced
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19746
Homologene: 7918
Name: SRY (sex determining region Y)-box 15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20670
Homologene: 74586
Name: olfactory receptor family 6 subfamily C member 88
Synonyms: GA_x6K02T2PULF-11248702-11249664, MOR114-11, Olfr794
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258375
Homologene: 45066
Name: SH3-domain binding protein 5 (BTK-associated)
Synonyms: Sab
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 24056
Homologene: 23450
Name: predicted gene 13762
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Name: IQ motif and ankyrin repeat containing 1
Synonyms: K230010J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 432964
Homologene: 141000
Name: calcium homeostasis modulator 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 240669
VEGA: 19
Name: chemokine (C-X-C motif) ligand 3
Synonyms: Dcip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330122
Homologene: 138183
Name: predicted gene 16092
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 37,452,263 bp
  • T to G, chromosome 1 at 85,512,968 bp
  • T to A, chromosome 2 at 82,977,491 bp
  • A to T, chromosome 2 at 85,353,276 bp
  • T to C, chromosome 2 at 88,973,013 bp
  • A to G, chromosome 2 at 111,664,363 bp
  • A to G, chromosome 3 at 5,402,138 bp
  • G to A, chromosome 3 at 38,951,239 bp
  • A to G, chromosome 3 at 95,293,756 bp
  • C to T, chromosome 3 at 158,023,344 bp
  • T to A, chromosome 4 at 81,284,614 bp
  • T to A, chromosome 4 at 134,895,976 bp
  • T to G, chromosome 4 at 139,357,620 bp
  • T to C, chromosome 4 at 152,317,928 bp
  • T to C, chromosome 4 at 154,347,954 bp
  • C to T, chromosome 5 at 90,786,316 bp
  • T to A, chromosome 5 at 90,801,366 bp
  • A to T, chromosome 5 at 120,805,533 bp
  • A to G, chromosome 6 at 28,874,859 bp
  • T to C, chromosome 6 at 32,234,606 bp
  • T to A, chromosome 6 at 42,817,767 bp
  • A to T, chromosome 6 at 132,868,053 bp
  • A to G, chromosome 6 at 142,248,717 bp
  • A to G, chromosome 7 at 18,262,688 bp
  • A to C, chromosome 7 at 29,046,865 bp
  • A to T, chromosome 7 at 34,165,490 bp
  • C to T, chromosome 7 at 97,685,559 bp
  • A to G, chromosome 8 at 56,547,422 bp
  • A to G, chromosome 9 at 96,611,389 bp
  • C to T, chromosome 9 at 108,113,009 bp
  • A to G, chromosome 10 at 4,966,245 bp
  • A to G, chromosome 10 at 6,908,029 bp
  • A to G, chromosome 10 at 60,752,784 bp
  • A to G, chromosome 10 at 129,571,527 bp
  • C to T, chromosome 11 at 69,655,730 bp
  • A to G, chromosome 11 at 70,394,867 bp
  • A to C, chromosome 11 at 84,442,574 bp
  • G to A, chromosome 11 at 98,435,571 bp
  • A to G, chromosome 11 at 119,346,799 bp
  • T to A, chromosome 12 at 16,717,258 bp
  • T to A, chromosome 12 at 116,429,657 bp
  • C to T, chromosome 14 at 30,103,735 bp
  • T to C, chromosome 14 at 31,387,834 bp
  • G to A, chromosome 15 at 76,045,432 bp
  • T to A, chromosome 17 at 25,878,912 bp
  • T to G, chromosome 17 at 69,259,071 bp
  • C to A, chromosome 18 at 60,245,652 bp
  • T to A, chromosome 18 at 90,527,934 bp
  • ATCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTC, chromosome 19 at 46,071,316 bp
  • T to C, chromosome 19 at 46,268,452 bp
  • T to C, chromosome 19 at 47,152,077 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5938 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044131-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.