Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5938Btlr/Mmmh
Stock Number:
044131-MU
Citation ID:
RRID:MMRRC_044131-MU
Other Names:
R5938 (G1)
Major Collection:

Strain Information

Aatf
Name: apoptosis antagonizing transcription factor
Synonyms: 4933415H02Rik, Trb, 5830465M17Rik, Che-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56321
Homologene: 40811
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Srsf11
Name: serine and arginine-rich splicing factor 11
Synonyms: 0610009J05Rik, 2610019N13Rik, Sfrs11
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69207
Homologene: 36164
Uba2
Name: ubiquitin-like modifier activating enzyme 2
Synonyms: Sumo-1 activating enzyme subunit 2, UBA2, anthracycline-associated resistance, Arx, SAE2, Uble1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50995
Homologene: 4018
Pelp1
Name: proline, glutamic acid and leucine rich protein 1
Synonyms: 4930563C04Rik, MNAR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75273
Homologene: 8664
Snd1
Name: staphylococcal nuclease and tudor domain containing 1
Synonyms: p100 co-activator, Tudor-SN
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56463
Homologene: 8665
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 37,452,263 bp
  • T to G, chromosome 1 at 85,512,968 bp
  • T to A, chromosome 2 at 82,977,491 bp
  • A to T, chromosome 2 at 85,353,276 bp
  • T to C, chromosome 2 at 88,973,013 bp
  • A to G, chromosome 2 at 111,664,363 bp
  • A to G, chromosome 3 at 5,402,138 bp
  • G to A, chromosome 3 at 38,951,239 bp
  • A to G, chromosome 3 at 95,293,756 bp
  • C to T, chromosome 3 at 158,023,344 bp
  • T to A, chromosome 4 at 81,284,614 bp
  • T to A, chromosome 4 at 134,895,976 bp
  • T to G, chromosome 4 at 139,357,620 bp
  • T to C, chromosome 4 at 152,317,928 bp
  • T to C, chromosome 4 at 154,347,954 bp
  • C to T, chromosome 5 at 90,786,316 bp
  • T to A, chromosome 5 at 90,801,366 bp
  • A to T, chromosome 5 at 120,805,533 bp
  • A to G, chromosome 6 at 28,874,859 bp
  • T to C, chromosome 6 at 32,234,606 bp
  • T to A, chromosome 6 at 42,817,767 bp
  • A to T, chromosome 6 at 132,868,053 bp
  • A to G, chromosome 6 at 142,248,717 bp
  • A to G, chromosome 7 at 18,262,688 bp
  • A to C, chromosome 7 at 29,046,865 bp
  • A to T, chromosome 7 at 34,165,490 bp
  • C to T, chromosome 7 at 97,685,559 bp
  • A to G, chromosome 8 at 56,547,422 bp
  • A to G, chromosome 9 at 96,611,389 bp
  • C to T, chromosome 9 at 108,113,009 bp
  • A to G, chromosome 10 at 4,966,245 bp
  • A to G, chromosome 10 at 6,908,029 bp
  • A to G, chromosome 10 at 60,752,784 bp
  • A to G, chromosome 10 at 129,571,527 bp
  • C to T, chromosome 11 at 69,655,730 bp
  • A to G, chromosome 11 at 70,394,867 bp
  • A to C, chromosome 11 at 84,442,574 bp
  • G to A, chromosome 11 at 98,435,571 bp
  • A to G, chromosome 11 at 119,346,799 bp
  • T to A, chromosome 12 at 16,717,258 bp
  • T to A, chromosome 12 at 116,429,657 bp
  • C to T, chromosome 14 at 30,103,735 bp
  • T to C, chromosome 14 at 31,387,834 bp
  • G to A, chromosome 15 at 76,045,432 bp
  • T to A, chromosome 17 at 25,878,912 bp
  • T to G, chromosome 17 at 69,259,071 bp
  • C to A, chromosome 18 at 60,245,652 bp
  • T to A, chromosome 18 at 90,527,934 bp
  • ATCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTC, chromosome 19 at 46,071,316 bp
  • T to C, chromosome 19 at 46,268,452 bp
  • T to C, chromosome 19 at 47,152,077 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5938 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044131-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.