Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6360Btlr/Mmmh
Stock Number:
044510-MU
Citation ID:
RRID:MMRRC_044510-MU
Other Names:
R6360 (G1)
Major Collection:

Strain Information

Arhgap10
Name: Rho GTPase activating protein 10
Synonyms: PSGAP-s, PSGAP-m, A930033B01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78514
Homologene: 12695
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Ube2g1
Name: ubiquitin-conjugating enzyme E2G 1
Synonyms: 2700059C12Rik, D130023C12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67128
Homologene: 2508
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: E130319N12Rik, 2810017C20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215351
Homologene: 9196
Tbc1d22a
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223754
VEGA: 15
HGNC: HGNC:1309
Homologene: 105406
Kpnb1
Name: karyopherin subunit beta 1
Synonyms: Impnb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16211
HGNC: HGNC:6400
Homologene: 1707
Dab2ip
Name: disabled 2 interacting protein
Synonyms: 2310011D08Rik, AIP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69601
Homologene: 13058
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 39,680,965 bp
  • T to C, chromosome 1 at 97,792,539 bp
  • C to T, chromosome 1 at 100,431,736 bp
  • G to T, chromosome 1 at 181,832,155 bp
  • A to G, chromosome 2 at 35,710,266 bp
  • T to A, chromosome 2 at 59,214,747 bp
  • C to T, chromosome 2 at 172,432,611 bp
  • T to C, chromosome 2 at 181,391,455 bp
  • A to G, chromosome 3 at 93,290,601 bp
  • G to A, chromosome 3 at 96,176,728 bp
  • T to A, chromosome 4 at 25,265,476 bp
  • T to C, chromosome 4 at 64,000,733 bp
  • T to C, chromosome 4 at 98,969,662 bp
  • T to C, chromosome 4 at 133,486,756 bp
  • A to T, chromosome 5 at 34,674,537 bp
  • T to C, chromosome 5 at 105,083,730 bp
  • T to C, chromosome 5 at 113,961,347 bp
  • C to T, chromosome 6 at 39,493,142 bp
  • G to T, chromosome 6 at 40,544,713 bp
  • A to C, chromosome 6 at 42,400,835 bp
  • A to G, chromosome 6 at 56,779,206 bp
  • G to T, chromosome 6 at 124,438,429 bp
  • A to T, chromosome 6 at 125,683,526 bp
  • A to T, chromosome 7 at 3,736,504 bp
  • A to G, chromosome 7 at 36,769,441 bp
  • A to C, chromosome 7 at 42,708,482 bp
  • T to C, chromosome 7 at 64,389,955 bp
  • T to A, chromosome 7 at 110,027,129 bp
  • T to A, chromosome 7 at 118,633,966 bp
  • T to A, chromosome 8 at 25,861,180 bp
  • G to A, chromosome 8 at 77,259,202 bp
  • A to G, chromosome 8 at 81,902,852 bp
  • T to A, chromosome 9 at 80,113,806 bp
  • C to A, chromosome 10 at 39,526,883 bp
  • A to C, chromosome 11 at 23,655,690 bp
  • A to T, chromosome 11 at 72,663,082 bp
  • G to T, chromosome 11 at 75,515,669 bp
  • T to C, chromosome 11 at 97,173,270 bp
  • T to A, chromosome 11 at 97,692,409 bp
  • C to A, chromosome 12 at 83,797,262 bp
  • A to T, chromosome 13 at 21,072,583 bp
  • A to C, chromosome 13 at 34,901,433 bp
  • T to G, chromosome 14 at 8,299,619 bp
  • T to C, chromosome 14 at 62,361,419 bp
  • A to G, chromosome 15 at 13,041,460 bp
  • CCCCTGCATGAGGCAGGTCCC to CCCC, chromosome 15 at 76,597,455 bp
  • C to T, chromosome 15 at 86,214,629 bp
  • A to T, chromosome 16 at 5,172,995 bp
  • C to T, chromosome 16 at 11,084,792 bp
  • T to C, chromosome 16 at 17,838,066 bp
  • T to A, chromosome 16 at 46,411,109 bp
  • T to C, chromosome 17 at 12,004,052 bp
  • A to T, chromosome 18 at 10,116,778 bp
  • A to T, chromosome 18 at 10,574,931 bp
  • T to C, chromosome 18 at 35,686,709 bp
  • A to T, chromosome 18 at 37,422,159 bp
  • A to G, chromosome 19 at 5,092,341 bp
  • T to C, chromosome 19 at 5,760,571 bp
  • T to C, chromosome 19 at 10,479,481 bp
  • T to C, chromosome 19 at 59,300,983 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6360 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044510-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.