Strain Name:
C57BL/6J-MtgxR6360Btlr/Mmmh
Stock Number:
044510-MU
Citation ID:
RRID:MMRRC_044510-MU
Other Names:
R6360 (G1)
Major Collection:

Strain Information

Arhgap10
Name: Rho GTPase activating protein 10
Synonyms: A930033B01Rik, PSGAP-m, PSGAP-s
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78514
Homologene: 12695
Pkp4
Name: plakophilin 4
Synonyms: 5031422I09Rik, 9430019K17Rik, Armrp, p0071
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Ube2g1
Name: ubiquitin-conjugating enzyme E2G 1
Synonyms: 2700059C12Rik, D130023C12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67128
Homologene: 2508
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: E130319N12Rik, 2810017C20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215351
Homologene: 9196
Tbc1d22a
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223754
VEGA: 15
HGNC: HGNC:1309
Homologene: 105406
Kpnb1
Name: karyopherin subunit beta 1
Synonyms: Impnb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16211
HGNC: HGNC:6400
Homologene: 1707
Dab2ip
Name: disabled 2 interacting protein
Synonyms: AIP1, 2310011D08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69601
Homologene: 13058
Prpf4b
Name: pre-mRNA processing factor 4B
Synonyms: Prpk, Prp4k, Prp4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19134
VEGA: 13
Homologene: 134085
Ipo7
Name: importin 7
Synonyms: A330055O14Rik, Imp7, RanBP7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233726
HGNC: HGNC:9852
Homologene: 4659
Ufl1
Name: UFM1 specific ligase 1
Synonyms: Maxer, 1810074P20Rik, Rcad
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67490
Homologene: 9093
Mphosph10
Name: M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Synonyms: 2810453H10Rik, 5730405D16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67973
HGNC: HGNC:7213
Homologene: 134741
Pcgf2
Name: polycomb group ring finger 2
Synonyms: Zfp144, Mel18, mel-18, Rnf110
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22658
Homologene: 5174
Rock1
Name: Rho-associated coiled-coil containing protein kinase 1
Synonyms: Rock-I, 1110055K06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19877
VEGA: 18
Homologene: 55899
Nectin3
Name: nectin cell adhesion molecule 3
Synonyms: Pvrl3, nectin-3, 2610301B19Rik, 3000002N23Rik, 4921513D19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 58998
Homologene: 9162
Dock7
Name: dedicator of cytokinesis 7
Synonyms: LOC242555, 3110056M06Rik, m
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67299
Homologene: 23566
Numb
Name: NUMB endocytic adaptor protein
Synonyms: m-numb
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18222
HGNC: HGNC:8060
Homologene: 2775
Sf3b4
Name: splicing factor 3b, subunit 4
Synonyms: Sap49, 49kDa, SF3b49
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 107701
Homologene: 134086
Tnc
Name: tenascin C
Synonyms: hexabrachion, C130033P17Rik, cytotactin, TN-C, tenascin-C, Hxb, TN
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Dnajc18
Name: DnaJ heat shock protein family (Hsp40) member C18
Synonyms: 2700075B01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 76594
VEGA: 18
Homologene: 23692
Esco1
Name: establishment of sister chromatid cohesion N-acetyltransferase 1
Synonyms: A930014I12Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 77805
Homologene: 62166
Lbr
Name: lamin B receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98386
HGNC: HGNC:6518
Homologene: 2455
Gin1
Name: gypsy retrotransposon integrase 1
Synonyms: 4930429M06, 4930429M06Rik, Zh2c2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 252876
Homologene: 69238
Dennd2a
Name: DENN domain containing 2A
Synonyms: B930096L08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209773
Homologene: 35238
Ssh1
Name: slingshot protein phosphatase 1
Synonyms: mSSH-1L, LOC384311
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231637
Homologene: 41299
Cdh6
Name: cadherin 6
Synonyms: K-cadherin, cad6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12563
VEGA: 15
HGNC: HGNC:1765
Homologene: 21027
Kbtbd2
Name: kelch repeat and BTB (POZ) domain containing 2
Synonyms: Bklhd1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 210973
Homologene: 17122
Rfx8
Name: regulatory factor X 8
Synonyms: 4933400N17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 619289
Homologene: 82436
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Kcnma3, Slo3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16532
Homologene: 7392
Txndc11
Name: thioredoxin domain containing 11
Synonyms: Txdc11, 2810408E11Rik, EF-hand binding protein 1, EFP1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106200
Homologene: 9301
Pcdhb11
Name: protocadherin beta 11
Synonyms: PcdhbK, Pcdhb5E
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93882
HGNC: HGNC:8690
Homologene: 62178
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Gm17067
Name: predicted gene 17067
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 115486519
Pdzd8
Name: PDZ domain containing 8
Synonyms: Pdzk8, A630041P07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
Vwf
Name: Von Willebrand factor
Synonyms: 6820430P06Rik, B130011O06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22371
Homologene: 466
Cass4
Name: Cas scaffolding protein family member 4
Synonyms: F730031O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320664
Homologene: 75128
Flg
Name: filaggrin
Synonyms: profilaggrin, fillagrin, ft
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14246
VEGA: 3
Clstn3
Name: calsyntenin 3
Synonyms: Cst-3, CSTN3, alcadein-beta, Clstn3b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232370
Homologene: 22836
Tshz3
Name: teashirt zinc finger family member 3
Synonyms: A630038G13Rik, Tsh3, Zfp537, teashirt3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243931
Homologene: 10835
Tmc5
Name: transmembrane channel-like gene family 5
Synonyms: 4932443L08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74424
Homologene: 11713
Scarf1
Name: scavenger receptor class F, member 1
Synonyms: SREC, SREC-I
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380713
Homologene: 2741
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Grk4
Name: G protein-coupled receptor kinase 4
Synonyms: A830025H08Rik, Gprk2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14772
HGNC: HGNC:4543
Homologene: 23158
Tas2r143
Name: taste receptor, type 2, member 143
Synonyms: Tas2r43, mt2r36
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387514
Homologene: 74285
Zbtb46
Name: zinc finger and BTB domain containing 46
Synonyms: 2610019F01Rik, Btbd4, 4933406L05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72147
Homologene: 81908
Fyn
Name: Fyn proto-oncogene
Synonyms: Src Kinase p59
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14360
HGNC: HGNC:4037
Homologene: 48068
Cntnap5b
Name: contactin associated protein-like 5B
Synonyms: Caspr5-2, C230078M14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241175
Homologene: 104295
Sec14l5
Name: SEC14-like lipid binding 5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 665119
VEGA: 16
Homologene: 96163
Saxo4
Name: stabilizer of axonemal microtubules 4
Synonyms: IIIG9, IIIG9L, 4930579J09Rik, Ppp1r32, IIIG9S
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67752
VEGA: 19
Homologene: 15863
Or2p2
Name: olfactory receptor family 2 subfamily P member 2
Synonyms: GA_x6K02T2QHY8-12181473-12182423, Olfr1370, MOR256-14
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258528
Homologene: 105231
Or9a7
Name: olfactory receptor family 9 subfamily A member 7
Synonyms: GA_x6K02T2P3E9-6973252-6974193, MOR120-3, Olfr461
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258380
HGNC: HGNC:8486
Homologene: 64891
Prkn
Name: parkin RBR E3 ubiquitin protein ligase
Synonyms: Park2, PRKN, Parkin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50873
HGNC: HGNC:8607
Homologene: 3355
Tent5b
Name: terminal nucleotidyltransferase 5B
Synonyms: Fam46b, 4732473B16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100342
Homologene: 24928
Car15
Name: carbonic anhydrase 15
Synonyms: Cals2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 80733
Homologene: 113791
Gbp9
Name: guanylate-binding protein 9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 236573
Homologene: 128731
Pex13
Name: peroxisomal biogenesis factor 13
Synonyms: 2610008O20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72129
HGNC: HGNC:8855
Homologene: 1967
Fam107a
Name: family with sequence similarity 107, member A
Synonyms: DRR1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268709
Homologene: 48509
Rnaseh2b
Name: ribonuclease H2, subunit B
Synonyms: 2610207P08Rik, 1110019N06Rik, Dleu8
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67153
Homologene: 41572
Gm15922
Name: predicted gene 15922
Type: Gene
Species: Mouse
Chromosome: 7
Yif1a
Name: Yip1 interacting factor homolog A (S. cerevisiae)
Synonyms: 54TM, Yif1p, 5330422J23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68090
VEGA: 19
Homologene: 56295
Scyl1
Name: SCY1-like 1 (S. cerevisiae)
Synonyms: mfd, Ntkl, p105, 2810011O19Rik, mdf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78891
VEGA: 19
Homologene: 6947
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 39,680,965 bp
  • T to C, chromosome 1 at 97,792,539 bp
  • C to T, chromosome 1 at 100,431,736 bp
  • G to T, chromosome 1 at 181,832,155 bp
  • A to G, chromosome 2 at 35,710,266 bp
  • T to A, chromosome 2 at 59,214,747 bp
  • C to T, chromosome 2 at 172,432,611 bp
  • T to C, chromosome 2 at 181,391,455 bp
  • A to G, chromosome 3 at 93,290,601 bp
  • G to A, chromosome 3 at 96,176,728 bp
  • T to A, chromosome 4 at 25,265,476 bp
  • T to C, chromosome 4 at 64,000,733 bp
  • T to C, chromosome 4 at 98,969,662 bp
  • T to C, chromosome 4 at 133,486,756 bp
  • A to T, chromosome 5 at 34,674,537 bp
  • T to C, chromosome 5 at 105,083,730 bp
  • T to C, chromosome 5 at 113,961,347 bp
  • C to T, chromosome 6 at 39,493,142 bp
  • G to T, chromosome 6 at 40,544,713 bp
  • A to C, chromosome 6 at 42,400,835 bp
  • A to G, chromosome 6 at 56,779,206 bp
  • G to T, chromosome 6 at 124,438,429 bp
  • A to T, chromosome 6 at 125,683,526 bp
  • A to T, chromosome 7 at 3,736,504 bp
  • A to G, chromosome 7 at 36,769,441 bp
  • A to C, chromosome 7 at 42,708,482 bp
  • T to C, chromosome 7 at 64,389,955 bp
  • T to A, chromosome 7 at 110,027,129 bp
  • T to A, chromosome 7 at 118,633,966 bp
  • T to A, chromosome 8 at 25,861,180 bp
  • G to A, chromosome 8 at 77,259,202 bp
  • A to G, chromosome 8 at 81,902,852 bp
  • T to A, chromosome 9 at 80,113,806 bp
  • C to A, chromosome 10 at 39,526,883 bp
  • A to C, chromosome 11 at 23,655,690 bp
  • A to T, chromosome 11 at 72,663,082 bp
  • G to T, chromosome 11 at 75,515,669 bp
  • T to C, chromosome 11 at 97,173,270 bp
  • T to A, chromosome 11 at 97,692,409 bp
  • C to A, chromosome 12 at 83,797,262 bp
  • A to T, chromosome 13 at 21,072,583 bp
  • A to C, chromosome 13 at 34,901,433 bp
  • T to G, chromosome 14 at 8,299,619 bp
  • T to C, chromosome 14 at 62,361,419 bp
  • A to G, chromosome 15 at 13,041,460 bp
  • CCCCTGCATGAGGCAGGTCCC to CCCC, chromosome 15 at 76,597,455 bp
  • C to T, chromosome 15 at 86,214,629 bp
  • A to T, chromosome 16 at 5,172,995 bp
  • C to T, chromosome 16 at 11,084,792 bp
  • T to C, chromosome 16 at 17,838,066 bp
  • T to A, chromosome 16 at 46,411,109 bp
  • T to C, chromosome 17 at 12,004,052 bp
  • A to T, chromosome 18 at 10,116,778 bp
  • A to T, chromosome 18 at 10,574,931 bp
  • T to C, chromosome 18 at 35,686,709 bp
  • A to T, chromosome 18 at 37,422,159 bp
  • A to G, chromosome 19 at 5,092,341 bp
  • T to C, chromosome 19 at 5,760,571 bp
  • T to C, chromosome 19 at 10,479,481 bp
  • T to C, chromosome 19 at 59,300,983 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6360 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044510-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.