Strain Name:
C57BL/6J-MtgxR6574Btlr/Mmmh
Stock Number:
044698-MU
Citation ID:
RRID:MMRRC_044698-MU
Other Names:
R6574 (G1)
Major Collection:

Strain Information

Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluA2, Glur2, GluR2, GluR-B, Glur-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Pmp22
Name: peripheral myelin protein 22
Synonyms: TRE002, Gas-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18858
HGNC: HGNC:9118
Homologene: 7482
Eps8
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Ptbp2
Name: polypyrimidine tract binding protein 2
Synonyms: brPTB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56195
Homologene: 23162
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Ackr3
Name: atypical chemokine receptor 3
Synonyms: Rdc1, Cxcr7, Cmkor1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12778
Homologene: 22419
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: Dnahc7, LOC381341, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Ppp1r15a
Name: protein phosphatase 1, regulatory subunit 15A
Synonyms: Gadd34, Myd116
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17872
Homologene: 8639
Degs1
Name: delta 4-desaturase, sphingolipid 1
Synonyms: Des1, Mdes
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13244
Homologene: 55770
Arap1
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Synonyms: 2410002L19Rik, Centd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69710
Homologene: 12326
Sucnr1
Name: succinate receptor 1
Synonyms: Gpr91
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84112
HGNC: HGNC:4542
Homologene: 41865
Iqcb1
Name: IQ calmodulin-binding motif containing 1
Synonyms: NPHP5, 6820449I09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320299
Homologene: 8766
Sez6l
Name: seizure related 6 homolog like
Synonyms: Acig1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56747
Homologene: 10895
Pkd2l2
Name: polycystic kidney disease 2-like 2
Synonyms: TRPP5, Polycystin - L2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 53871
VEGA: 18
HGNC: HGNC:9012
Homologene: 22812
Eif4e1b
Name: eukaryotic translation initiation factor 4E family member 1B
Synonyms: Eif4eloo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218268
Homologene: 100945
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Slc4a8
Name: solute carrier family 4 (anion exchanger), member 8
Synonyms: NDCBE, KNBC-3, sodium bicarbonate cotransporter isoform 3 kNBC-3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 59033
Homologene: 68419
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: Dnahc9, D11Ertd686e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Plcb2
Name: phospholipase C, beta 2
Synonyms: B230205M18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18796
HGNC: HGNC:9055
Homologene: 20957
Ucp1
Name: uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms: Slc25a7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22227
Homologene: 22524
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 1110004P15Rik, 2310047C17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Odad2
Name: outer dynein arm docking complex subunit 2
Synonyms: Armc4, 4930463I21Rik, b2b227.1Clo, b2b643Clo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74934
VEGA: 18
Homologene: 9992
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Myo1c
Name: myosin IC
Synonyms: mm1beta, C80397, myr2, myosin-Ibeta
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17913
HGNC: HGNC:7597
Homologene: 32046
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Ccdc83
Name: coiled-coil domain containing 83
Synonyms: 4930554C01Rik, 4932423M01Rik, 4930549K11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75338
Homologene: 32709
Ccno
Name: cyclin O
Synonyms: Ccnu, Ung2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218630
VEGA: 13
Homologene: 50171
4930503B20Rik
Name: RIKEN cDNA 4930503B20 gene
Type: Gene
Species: Mouse
Chromosome: 3
Homologene: 41344
Gss
Name: glutathione synthetase
Synonyms: GS-A/GS-B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14854
HGNC: HGNC:4624
Homologene: 148
Ppp2r3a
Name: protein phosphatase 2, regulatory subunit B'', alpha
Synonyms: 3222402P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235542
HGNC: HGNC:9307
Homologene: 20595
Tmem67
Name: transmembrane protein 67
Synonyms: b2b1163.1Clo, b2b1291.1Clo, 5330408M12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329795
Homologene: 71886
Flt4
Name: FMS-like tyrosine kinase 4
Synonyms: VEGFR-3, Flt-4, VEGFR3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14257
HGNC: HGNC:3767
Homologene: 7321
Vps52
Name: VPS52 GARP complex subunit
Synonyms: Sacm2l, tclw5, tcl-w5, D430041K17Rik, ARE1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224705
Homologene: 5756
Trgc3
Name: T cell receptor gamma, constant 3
Synonyms: Tcrg-C3, Gm17356
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107575
Igkv13-84
Name: immunoglobulin kappa chain variable 13-84
Synonyms: Igk-V33
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 692152
Etfa
Name: electron transferring flavoprotein, alpha polypeptide
Synonyms: 2010200I21Rik, D9Ertd394e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110842
HGNC: HGNC:3481
Homologene: 100
Ubash3a
Name: ubiquitin associated and SH3 domain containing, A
Synonyms: Sts-2, 5830413C03Rik, TULA
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328795
Homologene: 56833
Gabra4
Name: gamma-aminobutyric acid type A receptor subunit alpha 4
Synonyms: Gabra-4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14397
HGNC: HGNC:4078
Homologene: 631
Slc25a10
Name: solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10
Synonyms: Dic
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27376
Homologene: 6519
Pcdhga5
Name: protocadherin gamma subfamily A, 5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93713
HGNC: HGNC:8703
Homologene: 69263
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 53,456,534 bp
  • T to C, chromosome 1 at 90,214,068 bp
  • T to C, chromosome 1 at 182,279,073 bp
  • G to A, chromosome 2 at 12,230,161 bp
  • T to C, chromosome 2 at 118,719,173 bp
  • G to T, chromosome 2 at 155,582,011 bp
  • T to C, chromosome 3 at 60,086,599 bp
  • A to G, chromosome 3 at 80,689,296 bp
  • T to G, chromosome 3 at 119,747,947 bp
  • A to C, chromosome 3 at 146,650,858 bp
  • T to C, chromosome 4 at 12,063,086 bp
  • A to G, chromosome 5 at 71,623,925 bp
  • A to G, chromosome 5 at 112,576,826 bp
  • G to T, chromosome 5 at 144,815,550 bp
  • C to A, chromosome 6 at 68,939,993 bp
  • A to T, chromosome 6 at 137,483,598 bp
  • T to C, chromosome 7 at 45,524,109 bp
  • C to T, chromosome 7 at 55,823,583 bp
  • T to C, chromosome 7 at 90,226,677 bp
  • T to A, chromosome 7 at 101,404,001 bp
  • A to C, chromosome 7 at 144,607,916 bp
  • G to A, chromosome 8 at 83,294,089 bp
  • A to T, chromosome 9 at 55,495,626 bp
  • G to A, chromosome 9 at 101,194,385 bp
  • A to G, chromosome 9 at 108,113,954 bp
  • A to G, chromosome 11 at 49,625,372 bp
  • C to T, chromosome 11 at 63,158,273 bp
  • C to T, chromosome 11 at 66,168,281 bp
  • T to G, chromosome 11 at 75,656,298 bp
  • T to C, chromosome 11 at 120,497,077 bp
  • G to T, chromosome 13 at 19,261,123 bp
  • T to C, chromosome 13 at 54,784,898 bp
  • T to A, chromosome 13 at 112,988,185 bp
  • CCCCTGCATGAGGCAGGTCCC to CCCC, chromosome 15 at 76,597,455 bp
  • A to G, chromosome 15 at 100,807,316 bp
  • A to T, chromosome 16 at 36,871,501 bp
  • G to T, chromosome 17 at 18,256,159 bp
  • A to T, chromosome 17 at 31,232,396 bp
  • A to G, chromosome 17 at 33,962,478 bp
  • C to A, chromosome 18 at 7,129,394 bp
  • T to C, chromosome 18 at 34,425,081 bp
  • T to C, chromosome 18 at 37,695,381 bp
  • A to T, chromosome 19 at 9,017,047 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6574 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044698-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.