Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6776Btlr/Mmmh
Stock Number:
044892-MU
Citation ID:
RRID:MMRRC_044892-MU
Other Names:
R6776 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: A730065C02Rik, D230019K20Rik, 2700090M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Irx3
Name: Iroquois related homeobox 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16373
Homologene: 7385
Bmerb1
Name: bMERB domain containing 1
Synonyms: MINP, 2900011O08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67254
Homologene: 13236
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Ppp2r3c
Name: protein phosphatase 2, regulatory subunit B'', gamma
Synonyms: 5730412A08Rik, G4-1, G5pr, 4930511A21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 59032
VEGA: 12
Homologene: 9915
Slc7a7
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Synonyms: my+lat1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20540
Homologene: 88701
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Arid2
Name: AT-rich interaction domain 2
Synonyms: 4432409D24Rik, zipzap/p200, 1700124K17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77044
Homologene: 14601
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Ipo7
Name: importin 7
Synonyms: RanBP7, Imp7, A330055O14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233726
HGNC: HGNC:9852
Homologene: 4659
Hexa
Name: hexosaminidase A
Synonyms: Hex-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15211
VEGA: 9
HGNC: HGNC:4878
Homologene: 20146
Ttll4
Name: tubulin tyrosine ligase-like family, member 4
Synonyms: 4632407P03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67534
Homologene: 8764
Gapdh
Name: glyceraldehyde-3-phosphate dehydrogenase
Synonyms: Gapd, Gapd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14433
HGNC: HGNC:4141
Homologene: 107053
Plk2
Name: polo like kinase 2
Synonyms: Snk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20620
VEGA: 13
Homologene: 21317
Ecrg4
Name: ECRG4 augurin precursor
Synonyms: augurin, 1500015O10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78896
Homologene: 11505
Rhpn2
Name: rhophilin, Rho GTPase binding protein 2
Synonyms: 1300002E07Rik, D7Ertd784e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52428
Homologene: 12407
Anapc10
Name: anaphase promoting complex subunit 10
Synonyms: Apc10, 1500026N15Rik, A830003M23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68999
Homologene: 32238
Ttf2
Name: transcription termination factor, RNA polymerase II
Synonyms: 4632434F22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74044
Homologene: 37826
Firrm
Name: FIGNL1 interacting regulator of recombination and mitosis
Synonyms: BC055324, Flip
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381306
Homologene: 10058
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
Pkdrej
Name: polycystin (PKD) family receptor for egg jelly
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18766
VEGA: 15
HGNC: HGNC:9015
Homologene: 4427
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Jakmip1
Name: janus kinase and microtubule interacting protein 1
Synonyms: Marlin-1, 5830437M04Rik, C330021K24Rik, Gababrbp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76071
Homologene: 90789
Tnfaip3
Name: tumor necrosis factor, alpha-induced protein 3
Synonyms: A20, zinc finger protein A20, Tnfip3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21929
Homologene: 4582
Krt86
Name: keratin 86
Synonyms: MHb4, Krt2-11, Khb4, Krt2-10
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16679
VEGA: 15
HGNC: HGNC:6463
Homologene: 1717
Oas3
Name: 2'-5' oligoadenylate synthetase 3
Synonyms: 2'-5' oligoadenylate synthetase-like 10, Oasl10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246727
HGNC: HGNC:8088
Homologene: 4510
Plekha4
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms: PEPP1, 2410005C22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69217
Homologene: 10848
Pcnx1
Name: pecanex 1
Synonyms: 3526401J03Rik, 2900024E21Rik, Pcnx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
Thsd7a
Name: thrombospondin, type I, domain containing 7A
Synonyms: LOC330267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330267
Homologene: 46582
Prpf40b
Name: pre-mRNA processing factor 40B
Synonyms: 2610317D23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54614
Homologene: 81828
Mroh5
Name: maestro heat-like repeat family member 5
Synonyms: LOC268816, Gm628
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268816
Dpp10
Name: dipeptidylpeptidase 10
Synonyms: DPRP3, 6430601K09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269109
Homologene: 41400
Prrt4
Name: proline-rich transmembrane protein 4
Synonyms: D330027H18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101359
Homologene: 46116
Mtrf1
Name: mitochondrial translational release factor 1
Synonyms: A830062K05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211253
VEGA: 14
HGNC: HGNC:7469
Homologene: 20903
Abhd13
Name: abhydrolase domain containing 13
Synonyms: 1110065L07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68904
Homologene: 6716
Ppp2r3a
Name: protein phosphatase 2, regulatory subunit B'', alpha
Synonyms: 3222402P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235542
HGNC: HGNC:9307
Homologene: 20595
Pla2g5
Name: phospholipase A2, group V
Synonyms: sPLA2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18784
HGNC: HGNC:9038
Homologene: 716
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glur-6, Glur6, Glurbeta2, C130030K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
Pag1
Name: phosphoprotein associated with glycosphingolipid microdomains 1
Synonyms: F730007C19Rik, Cbp
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94212
Homologene: 10198
Kbtbd12
Name: kelch repeat and BTB (POZ) domain containing 12
Synonyms: 4833415F11Rik, 4933428M03Rik, Klhdc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74589
Homologene: 52613
Klk6
Name: kallikrein related-peptidase 6
Synonyms: Bssp, protease M, neurosin, Prss9, Klk29, Prss18
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19144
HGNC: HGNC:6367
Homologene: 68279
Vdr
Name: vitamin D (1,25-dihydroxyvitamin D3) receptor
Synonyms: Nr1i1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22337
Homologene: 37297
Gzmg
Name: granzyme G
Synonyms: Ctla-7, Ctla7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14944
VEGA: 14
Homologene: 133275
Igdcc4
Name: immunoglobulin superfamily, DCC subclass, member 4
Synonyms: 9330155G14Rik, WI-18508, Nope, WI-16786
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56741
VEGA: 9
Homologene: 10570
Gm5592
Name: predicted gene 5592
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434172
Homologene: 45597
Zfp663
Name: zinc finger protein 663
Synonyms: LOC381405, Gm1008
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381405
Homologene: 128277
Ftcd
Name: formiminotransferase cyclodeaminase
Synonyms: glutamate formiminotransferase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14317
HGNC: HGNC:3974
Homologene: 4848
Slc11a1
Name: solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1
Synonyms: host resistance locus Bcg/Ity/Lsh, Nramp, Bcg, Ity, Lsh, ity, Nramp1, Ity1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18173
Homologene: 73884
Cfap73
Name: cilia and flagella associated protein 73
Synonyms: Gm5988, Ccdc42b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 546886
Homologene: 53205
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 14,912,377 bp
  • C to A, chromosome 1 at 43,742,391 bp
  • T to A, chromosome 1 at 74,384,085 bp
  • A to G, chromosome 1 at 74,681,353 bp
  • G to A, chromosome 1 at 123,367,656 bp
  • T to C, chromosome 1 at 163,976,749 bp
  • T to C, chromosome 2 at 165,359,015 bp
  • T to C, chromosome 3 at 9,699,788 bp
  • A to T, chromosome 3 at 100,952,553 bp
  • A to G, chromosome 4 at 138,800,653 bp
  • G to A, chromosome 5 at 37,187,154 bp
  • G to T, chromosome 5 at 101,884,045 bp
  • A to G, chromosome 5 at 120,634,211 bp
  • A to T, chromosome 5 at 120,758,874 bp
  • G to A, chromosome 5 at 121,353,511 bp
  • C to T, chromosome 5 at 144,851,256 bp
  • T to A, chromosome 6 at 12,555,637 bp
  • G to T, chromosome 6 at 29,176,552 bp
  • A to G, chromosome 6 at 84,064,894 bp
  • T to C, chromosome 6 at 88,618,266 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,965 bp
  • A to G, chromosome 6 at 125,162,273 bp
  • T to A, chromosome 7 at 35,383,769 bp
  • C to G, chromosome 7 at 41,289,729 bp
  • T to C, chromosome 7 at 43,826,874 bp
  • C to A, chromosome 7 at 45,534,817 bp
  • A to G, chromosome 7 at 110,047,065 bp
  • A to G, chromosome 8 at 9,988,075 bp
  • T to C, chromosome 8 at 79,719,745 bp
  • T to A, chromosome 8 at 91,799,835 bp
  • G to T, chromosome 9 at 59,558,072 bp
  • A to T, chromosome 9 at 65,135,418 bp
  • A to G, chromosome 9 at 67,262,905 bp
  • A to T, chromosome 9 at 101,212,862 bp
  • T to G, chromosome 10 at 19,005,576 bp
  • G to A, chromosome 10 at 49,355,989 bp
  • T to C, chromosome 10 at 76,589,239 bp
  • A to C, chromosome 11 at 69,354,470 bp
  • T to A, chromosome 12 at 55,298,467 bp
  • C to T, chromosome 12 at 71,989,808 bp
  • C to T, chromosome 12 at 81,962,722 bp
  • T to C, chromosome 13 at 110,399,791 bp
  • C to T, chromosome 14 at 54,374,651 bp
  • C to T, chromosome 14 at 56,156,831 bp
  • T to C, chromosome 14 at 79,413,081 bp
  • A to G, chromosome 15 at 73,789,968 bp
  • C to T, chromosome 15 at 76,300,853 bp
  • C to T, chromosome 15 at 80,924,119 bp
  • G to T, chromosome 15 at 85,817,309 bp
  • A to G, chromosome 15 at 96,370,949 bp
  • T to C, chromosome 15 at 97,869,828 bp
  • C to T, chromosome 15 at 99,314,903 bp
  • T to C, chromosome 15 at 101,476,936 bp
  • T to A, chromosome 16 at 13,986,806 bp
  • C to T, chromosome 18 at 49,893,974 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6776 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044892-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.