Strain Name:
C57BL/6J-MtgxR6799Btlr/Mmmh
Stock Number:
044912-MU
Citation ID:
RRID:MMRRC_044912-MU
Other Names:
R6799 (G1)
Major Collection:

Strain Information

Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Rnmt2, Dnmt2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Dscaml1
Name: DS cell adhesion molecule like 1
Synonyms: 4930435C18Rik, 4921507G06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114873
VEGA: 9
Homologene: 79549
Dapk3
Name: death-associated protein kinase 3
Synonyms: ZIP kinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13144
VEGA: 10
HGNC: HGNC:2676
Homologene: 20353
Drosha
Name: drosha, ribonuclease type III
Synonyms: 1110013A17Rik, Etohi2, Rnasen
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14000
Homologene: 8293
Dhx38
Name: DEAH-box helicase 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Kpna6
Name: karyopherin subunit alpha 6
Synonyms: IPOA7, NPI-2, importin alpha 7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16650
HGNC: HGNC:6399
Homologene: 22472
Hdac4
Name: histone deacetylase 4
Synonyms: 4932408F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208727
Homologene: 55946
Sel1l
Name: sel-1 suppressor of lin-12-like (C. elegans)
Synonyms: Sel1h
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20338
Homologene: 31286
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Chaf1a
Name: chromatin assembly factor 1, subunit A
Synonyms: CAF-1, p150
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27221
VEGA: 17
HGNC: HGNC:1910
Homologene: 4003
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Pias1
Name: protein inhibitor of activated STAT 1
Synonyms: 2900068C24Rik, GBP, Ddxbp1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56469
VEGA: 9
HGNC: HGNC:2752
Homologene: 22953
Dtymk
Name: deoxythymidylate kinase
Synonyms: mtmk, D10Ertd203e, CDC8, TYPK, Tmk
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21915
HGNC: HGNC:3061
Homologene: 6285
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, NCAM-140, NCAM-180, E-NCAM, NCAM
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Egfr
Name: epidermal growth factor receptor
Synonyms: avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Erbb, Wa5, 9030024J15Rik, Errb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13649
HGNC: HGNC:3236
Homologene: 74545
Lpin1
Name: lipin 1
Synonyms: Lipin1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14245
VEGA: 12
Homologene: 9266
Tnc
Name: tenascin C
Synonyms: Hxb, TN-C, TN, C130033P17Rik, tenascin-C, cytotactin, hexabrachion
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Clca4b
Name: chloride channel accessory 4B
Synonyms: AI747448
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99709
HGNC: HGNC:2018
Homologene: 40808
Lrrtm3
Name: leucine rich repeat transmembrane neuronal 3
Synonyms: 9630044H04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216028
Homologene: 37110
Npat
Name: nuclear protein in the AT region
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244879
HGNC: HGNC:7896
Homologene: 1888
Dapk1
Name: death associated protein kinase 1
Synonyms: 2310039H24Rik, D13Ucla1, 2810425C21Rik, DAP-Kinase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Parm1
Name: prostate androgen-regulated mucin-like protein 1
Synonyms: 2210012L08Rik, 9130213B05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231440
Homologene: 41036
Ttyh1
Name: tweety family member 1
Synonyms: tty, 4930459B04Rik, 6330408P11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57776
Homologene: 10779
Slc9a5
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 5
Synonyms: LOC277973
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277973
Homologene: 31247
Mttp
Name: microsomal triglyceride transfer protein
Synonyms: MTP, 1810043K16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17777
HGNC: HGNC:7467
Homologene: 212
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Fcsk
Name: fucose kinase
Synonyms: L-fucose kinase, 1110046B12Rik, Fuk
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234730
Homologene: 15452
Hikeshi
Name: heat shock protein nuclear import factor
Synonyms: l(7)6Rn, 1110002N09Rik, 0610007P06Rik, Hikeshi, l7Rn6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67669
Homologene: 6908
Nlrp14
Name: NLR family, pyrin domain containing 14
Synonyms: 4921520L01Rik, Nalp14, GC-LRR, Nalp-iota
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76858
Homologene: 18531
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5c, Nav1.5, mH1, SkM2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Vmn2r110
Name: vomeronasal 2, receptor 110
Synonyms: EG224582
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224582
Homologene: 129678
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Vmn2r88
Name: vomeronasal 2, receptor 88
Synonyms: V2r13, V2r3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 669149
Homologene: 129606
Nt5dc1
Name: 5'-nucleotidase domain containing 1
Synonyms: 6030401B09Rik, Nt5c2l1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319638
Homologene: 16281
Albfm1
Name: albumin superfamily member 1
Synonyms: ARG, Gm17754, 5830473C10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 622307
Homologene: 129803
Hsdl1
Name: hydroxysteroid dehydrogenase like 1
Synonyms: 2700067E09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72552
Homologene: 100660
Parp2
Name: poly (ADP-ribose) polymerase family, member 2
Synonyms: PARP-2, C78626, Adprt2, Aspartl2, Adprtl2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11546
VEGA: 14
HGNC: HGNC:272
Homologene: 4004
Or51q1c
Name: olfactory receptor family 51 subfamily Q member 1C
Synonyms: GA_x6K02T2PBJ9-6737723-6738670, MOR5-1, Olfr638
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259124
Homologene: 133592
Psg20
Name: pregnancy-specific beta-1-glycoprotein 20
Synonyms: cea7, EG434540
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434540
Homologene: 110989
Fbxw24
Name: F-box and WD-40 domain protein 24
Synonyms: Gm5162
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382106
Homologene: 110776
Tyms
Name: thymidylate synthase
Synonyms: TS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22171
Homologene: 834
Arhgap26
Name: Rho GTPase activating protein 26
Synonyms: 1810044B20Rik, 2610010G17Rik, 4933432P15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71302
Homologene: 36349
Klf11
Name: Kruppel-like transcription factor 11
Synonyms: Tieg2b, D12Ertd427e, Tieg2, Tieg3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 194655
Homologene: 2668
Or8b35
Name: olfactory receptor family 8 subfamily B member 35
Synonyms: GA_x6K02T2PVTD-31676771-31677700, MOR162-7, Olfr881
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258413
Homologene: 74013
Pygm
Name: muscle glycogen phosphorylase
Synonyms: PG
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19309
HGNC: HGNC:9726
Homologene: 2145
Slc18a1
Name: solute carrier family 18 (vesicular monoamine), member 1
Synonyms: 4832416I10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110877
Homologene: 20664
1700018F24Rik
Name: RIKEN cDNA 1700018F24 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69396
Homologene: 86127
Vmn2r95
Name: vomeronasal 2, receptor 95
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328759
Homologene: 115024
Or10v5
Name: olfactory receptor family 10 subfamily V member 5
Synonyms: GA_x6K02T2RE5P-2172809-2171862, MOR266-2, Olfr1417
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258938
Homologene: 27304
Dagla
Name: diacylglycerol lipase, alpha
Synonyms: Nsddr
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 269060
HGNC: HGNC:1165
Homologene: 4468
Rcc1l
Name: reculator of chromosome condensation 1 like
Synonyms: 5730496C04Rik, Wbscr16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 94254
Homologene: 36477
E330034G19Rik
Name: RIKEN cDNA E330034G19 gene
Synonyms: ZPAC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105418
Slc30a3
Name: solute carrier family 30 (zinc transporter), member 3
Synonyms: Znt3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22784
Homologene: 74470
Arhgap18
Name: Rho GTPase activating protein 18
Synonyms: 4833419J07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73910
Homologene: 14135
Zfp128
Name: zinc finger protein 128
Synonyms: mZnf8, 9630016P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243833
Homologene: 10889
Kctd20
Name: potassium channel tetramerisation domain containing 20
Synonyms: D17Ertd562e, 2410004N11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66989
Homologene: 12063
Rfpl4b
Name: ret finger protein-like 4B
Synonyms: LOC215919, Gm62, Gm3037
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215919
Homologene: 130122
Hao1
Name: hydroxyacid oxidase 1, liver
Synonyms: GOX, Hao-1, Gox1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15112
HGNC: HGNC:4809
Homologene: 6578
Mfsd1
Name: major facilitator superfamily domain containing 1
Synonyms: 1200003O06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66868
Homologene: 11228
Rnf113a1
Name: ring finger protein 113A1
Synonyms: 2810428C21Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 69942
Homologene: 133822
Msc
Name: musculin
Synonyms: MyoR, bHLHa22
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17681
HGNC: HGNC:7321
Homologene: 3738
Ppif
Name: peptidylprolyl isomerase F (cyclophilin F)
Synonyms: CypD, CyP-F, CyP-D, mitochondrial Cyclophilin D
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105675
HGNC: HGNC:9259
Homologene: 38696
Cc2d2b
Name: coiled-coil and C2 domain containing 2B
Synonyms: EG668310
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668310
Homologene: 141114
Gm8797
Name: predicted pseudogene 8797
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 667759
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 14,755,267 bp
  • C to A, chromosome 1 at 92,002,213 bp
  • A to G, chromosome 1 at 93,798,492 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • A to G, chromosome 2 at 13,516,013 bp
  • T to C, chromosome 2 at 69,483,904 bp
  • C to G, chromosome 2 at 128,659,737 bp
  • T to C, chromosome 2 at 134,530,765 bp
  • G to A, chromosome 2 at 180,191,662 bp
  • A to T, chromosome 3 at 5,750,967 bp
  • T to C, chromosome 3 at 67,599,981 bp
  • T to C, chromosome 3 at 138,095,080 bp
  • A to T, chromosome 3 at 144,915,627 bp
  • C to T, chromosome 4 at 63,965,604 bp
  • A to G, chromosome 4 at 129,657,454 bp
  • C to T, chromosome 4 at 136,945,669 bp
  • T to A, chromosome 5 at 8,812,656 bp
  • A to T, chromosome 5 at 30,061,071 bp
  • A to G, chromosome 5 at 31,089,614 bp
  • A to G, chromosome 5 at 90,579,615 bp
  • C to T, chromosome 5 at 91,594,211 bp
  • A to T, chromosome 5 at 134,176,713 bp
  • A to T, chromosome 5 at 145,044,814 bp
  • G to T, chromosome 7 at 4,133,222 bp
  • A to T, chromosome 7 at 12,890,899 bp
  • A to G, chromosome 7 at 18,684,420 bp
  • T to A, chromosome 7 at 89,930,345 bp
  • T to A, chromosome 7 at 103,998,799 bp
  • A to G, chromosome 7 at 107,196,139 bp
  • T to A, chromosome 8 at 69,040,981 bp
  • A to T, chromosome 8 at 105,363,968 bp
  • A to G, chromosome 8 at 109,553,202 bp
  • T to C, chromosome 8 at 110,893,418 bp
  • T to C, chromosome 8 at 119,566,430 bp
  • T to C, chromosome 9 at 37,993,182 bp
  • G to A, chromosome 9 at 45,450,583 bp
  • T to C, chromosome 9 at 49,508,611 bp
  • A to T, chromosome 9 at 53,551,630 bp
  • G to T, chromosome 9 at 62,882,052 bp
  • T to A, chromosome 9 at 109,624,930 bp
  • A to C, chromosome 9 at 119,495,622 bp
  • C to T, chromosome 10 at 14,129,013 bp
  • T to A, chromosome 10 at 26,849,921 bp
  • A to G, chromosome 10 at 34,313,707 bp
  • T to C, chromosome 10 at 38,821,345 bp
  • A to T, chromosome 10 at 64,087,851 bp
  • A to G, chromosome 10 at 81,190,262 bp
  • G to A, chromosome 11 at 16,896,952 bp
  • T to A, chromosome 12 at 16,561,044 bp
  • T to C, chromosome 12 at 24,655,639 bp
  • A to G, chromosome 12 at 91,814,968 bp
  • A to G, chromosome 13 at 60,752,235 bp
  • A to G, chromosome 14 at 24,296,110 bp
  • A to G, chromosome 14 at 25,696,064 bp
  • T to C, chromosome 14 at 50,821,096 bp
  • C to A, chromosome 14 at 51,413,969 bp
  • T to A, chromosome 15 at 12,912,537 bp
  • C to T, chromosome 17 at 18,439,293 bp
  • T to A, chromosome 17 at 20,583,536 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • T to C, chromosome 17 at 28,963,377 bp
  • A to T, chromosome 17 at 56,047,059 bp
  • G to T, chromosome 18 at 22,465,400 bp
  • A to G, chromosome 18 at 39,099,607 bp
  • A to T, chromosome 19 at 6,398,127 bp
  • C to A, chromosome 19 at 10,256,850 bp
  • T to A, chromosome 19 at 11,828,814 bp
  • A to G, chromosome 19 at 40,791,208 bp
  • A to C, chromosome X at 37,192,187 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6799 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044912-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.