Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6799Btlr/Mmmh
Stock Number:
044912-MU
Citation ID:
RRID:MMRRC_044912-MU
Other Names:
R6799 (G1)
Major Collection:

Strain Information

Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Rnmt2, Dnmt2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Dscaml1
Name: DS cell adhesion molecule like 1
Synonyms: 4930435C18Rik, 4921507G06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114873
VEGA: 9
Homologene: 79549
Dapk3
Name: death-associated protein kinase 3
Synonyms: ZIP kinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13144
VEGA: 10
HGNC: HGNC:2676
Homologene: 20353
Drosha
Name: drosha, ribonuclease type III
Synonyms: 1110013A17Rik, Etohi2, Rnasen
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14000
Homologene: 8293
Dhx38
Name: DEAH-box helicase 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 14,755,267 bp
  • C to A, chromosome 1 at 92,002,213 bp
  • A to G, chromosome 1 at 93,798,492 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • A to G, chromosome 2 at 13,516,013 bp
  • T to C, chromosome 2 at 69,483,904 bp
  • C to G, chromosome 2 at 128,659,737 bp
  • T to C, chromosome 2 at 134,530,765 bp
  • G to A, chromosome 2 at 180,191,662 bp
  • A to T, chromosome 3 at 5,750,967 bp
  • T to C, chromosome 3 at 67,599,981 bp
  • T to C, chromosome 3 at 138,095,080 bp
  • A to T, chromosome 3 at 144,915,627 bp
  • C to T, chromosome 4 at 63,965,604 bp
  • A to G, chromosome 4 at 129,657,454 bp
  • C to T, chromosome 4 at 136,945,669 bp
  • T to A, chromosome 5 at 8,812,656 bp
  • A to T, chromosome 5 at 30,061,071 bp
  • A to G, chromosome 5 at 31,089,614 bp
  • A to G, chromosome 5 at 90,579,615 bp
  • C to T, chromosome 5 at 91,594,211 bp
  • A to T, chromosome 5 at 134,176,713 bp
  • A to T, chromosome 5 at 145,044,814 bp
  • G to T, chromosome 7 at 4,133,222 bp
  • A to T, chromosome 7 at 12,890,899 bp
  • A to G, chromosome 7 at 18,684,420 bp
  • T to A, chromosome 7 at 89,930,345 bp
  • T to A, chromosome 7 at 103,998,799 bp
  • A to G, chromosome 7 at 107,196,139 bp
  • T to A, chromosome 8 at 69,040,981 bp
  • A to T, chromosome 8 at 105,363,968 bp
  • A to G, chromosome 8 at 109,553,202 bp
  • T to C, chromosome 8 at 110,893,418 bp
  • T to C, chromosome 8 at 119,566,430 bp
  • T to C, chromosome 9 at 37,993,182 bp
  • G to A, chromosome 9 at 45,450,583 bp
  • T to C, chromosome 9 at 49,508,611 bp
  • A to T, chromosome 9 at 53,551,630 bp
  • G to T, chromosome 9 at 62,882,052 bp
  • T to A, chromosome 9 at 109,624,930 bp
  • A to C, chromosome 9 at 119,495,622 bp
  • C to T, chromosome 10 at 14,129,013 bp
  • T to A, chromosome 10 at 26,849,921 bp
  • A to G, chromosome 10 at 34,313,707 bp
  • T to C, chromosome 10 at 38,821,345 bp
  • A to T, chromosome 10 at 64,087,851 bp
  • A to G, chromosome 10 at 81,190,262 bp
  • G to A, chromosome 11 at 16,896,952 bp
  • T to A, chromosome 12 at 16,561,044 bp
  • T to C, chromosome 12 at 24,655,639 bp
  • A to G, chromosome 12 at 91,814,968 bp
  • A to G, chromosome 13 at 60,752,235 bp
  • A to G, chromosome 14 at 24,296,110 bp
  • A to G, chromosome 14 at 25,696,064 bp
  • T to C, chromosome 14 at 50,821,096 bp
  • C to A, chromosome 14 at 51,413,969 bp
  • T to A, chromosome 15 at 12,912,537 bp
  • C to T, chromosome 17 at 18,439,293 bp
  • T to A, chromosome 17 at 20,583,536 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • T to C, chromosome 17 at 28,963,377 bp
  • A to T, chromosome 17 at 56,047,059 bp
  • G to T, chromosome 18 at 22,465,400 bp
  • A to G, chromosome 18 at 39,099,607 bp
  • A to T, chromosome 19 at 6,398,127 bp
  • C to A, chromosome 19 at 10,256,850 bp
  • T to A, chromosome 19 at 11,828,814 bp
  • A to G, chromosome 19 at 40,791,208 bp
  • A to C, chromosome X at 37,192,187 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6799 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044912-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.