Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6801Btlr/Mmmh
Stock Number:
044914-MU
Citation ID:
RRID:MMRRC_044914-MU
Other Names:
R6801 (G1)
Major Collection:

Strain Information

Kcnc1
Name: potassium voltage gated channel, Shaw-related subfamily, member 1
Synonyms: Kv3.1, KV4, NGK2, KShIIIB, Shaw, Kcr2-1, C230009H10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16502
HGNC: HGNC:6233
Homologene: 68134
Mybl1
Name: myeloblastosis oncogene-like 1
Synonyms: A-myb, repro9, G1-419-6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17864
HGNC: HGNC:7547
Homologene: 32045
Ddx10
Name: DEAD box helicase 10
Synonyms: 4632415A01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77591
VEGA: 9
HGNC: HGNC:2735
Homologene: 20922
Shroom3
Name: shroom family member 3
Synonyms: D5Ertd287e, Shrm, Shrm3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27428
Homologene: 9263
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Fxr1
Name: FMR1 autosomal homolog 1
Synonyms: 1110050J02Rik, Fxr1p, 9530073J07Rik, Fxr1h
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14359
HGNC: HGNC:4023
Homologene: 3573
Trappc4
Name: trafficking protein particle complex 4
Synonyms: Sbd, 1500017G03Rik, HSPC172, PTD009, TRS23, Sbdn
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 60409
VEGA: 9
Homologene: 105453
Smc5
Name: structural maintenance of chromosomes 5
Synonyms: Smc5l1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226026
VEGA: 19
Homologene: 41009
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Hk1
Name: hexokinase 1
Synonyms: Hk-1, mHk1-s, Hk1-s
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15275
HGNC: HGNC:4922
Homologene: 100530
Suv39h2
Name: suppressor of variegation 3-9 2
Synonyms: 4930507K23Rik, Suv39h histone methyltransferase, D2Ertd544e, KMT1B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64707
Homologene: 32548
Rnf214
Name: ring finger protein 214
Synonyms: D130054N24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235315
Homologene: 109357
Phf13
Name: PHD finger protein 13
Synonyms: SPOC1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230936
Homologene: 17822
Atp2b4
Name: ATPase, Ca++ transporting, plasma membrane 4
Synonyms: PMCA4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381290
HGNC: HGNC:817
Homologene: 48034
Arhgap20
Name: Rho GTPase activating protein 20
Synonyms: 6530403F17Rik, A530023E23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244867
Homologene: 18938
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Ralgds
Name: ral guanine nucleotide dissociation stimulator
Synonyms: RalGDS, Rgds, Gnds
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19730
HGNC: HGNC:9842
Homologene: 4562
Arhgef11
Name: Rho guanine nucleotide exchange factor 11
Synonyms: PDZ-RhoGEF, Prg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213498
Homologene: 11409
Bche
Name: butyrylcholinesterase
Synonyms: C730038G20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12038
HGNC: HGNC:983
Homologene: 20065
Lingo2
Name: leucine rich repeat and Ig domain containing 2
Synonyms: B230217C06Rik, Lrrn6c, LERN3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242384
Homologene: 17621
Serpinb9c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9c
Synonyms: 3830421J05Rik, ovalbumin, Spi11, NK9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20707
HGNC: HGNC:8955
Or4k77
Name: olfactory receptor family 4 subfamily K member 77
Synonyms: GA_x6K02T2Q125-72420217-72421134, MOR248-19, Olfr1283
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228443
Homologene: 133657
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Or8g19
Name: olfactory receptor family 8 subfamily G member 19
Synonyms: MTPCR56, MOR171-6, GA_x6K02T2PVTD-32841223-32842158, GA_x6K02T2KYVW-1037-120, Olfr242, Olfr27
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258826
VEGA: 9
HGNC: HGNC:8484
Homologene: 110610
Trim12c
Name: tripartite motif-containing 12C
Synonyms: Trim12-2, 9230105E10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319236
Homologene: 75345
Rpusd2
Name: RNA pseudouridylate synthase domain containing 2
Synonyms: 4921503C21Rik, BB231107
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271842
Homologene: 5588
Or13c7
Name: olfactory receptor family 13 subfamily C member 7
Synonyms: OR37A, mOR37a, Olfr37a, GA_x6K02T2N78B-16092200-16091241, MOR262-14, Olfr155
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29845
Homologene: 84331
Fbxw13
Name: F-box and WD-40 domain protein 13
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 211305
Homologene: 110776
Myb
Name: myeloblastosis oncogene
Synonyms: c-myb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17863
HGNC: HGNC:7545
Homologene: 31311
Rftn2
Name: raftlin family member 2
Synonyms: 2700010E02Rik, 3222401M22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74013
Homologene: 16954
Prss33
Name: serine protease 33
Synonyms: tryptase-6, mT6, Eos
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 353130
Homologene: 77185
Adam3
Name: ADAM metallopeptidase domain 3
Synonyms: Taz83, tMDC, Cyrn1, ADAM3, Taz83
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11497
HGNC: HGNC:209
Homologene: 69052
Mylk4
Name: myosin light chain kinase family, member 4
Synonyms: EG238564
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238564
Homologene: 66243
Gmppa
Name: GDP-mannose pyrophosphorylase A
Synonyms: 1810012N01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69080
Homologene: 8346
Rpp14
Name: ribonuclease P 14 subunit
Synonyms: 2610511E03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67053
Homologene: 5113
Or5w1b
Name: olfactory receptor family 5 subfamily W member 1B
Synonyms: GA_x6K02T2Q125-49151278-49150337, MOR176-2, Olfr1133
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258348
Galm
Name: galactose mutarotase
Synonyms: aldose 1-epimerase, A530057M15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319625
Homologene: 71795
C2cd6
Name: C2 calcium dependent domain containing 6
Synonyms: 1700052H20Rik, 4930408G06Rik, Als2cr11, Als2cr11b, Gm33589, C2cd6b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73463
Homologene: 134310
Or2y16
Name: olfactory receptor family 2 subfamily Y member 16
Synonyms: GA_x6K02T2QP88-5991012-5990077, MOR256-28, Olfr1388
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258459
Homologene: 74258
Ccdc90b
Name: coiled-coil domain containing 90B
Synonyms: 2310015N07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66365
Homologene: 23328
Oxld1
Name: oxidoreductase like domain containing 1
Synonyms: 1810049H13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66431
Homologene: 49831
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Or4x12-ps1
Name: olfactory receptor family 4 subfamily X member 12, pseudogene 1
Synonyms: GA_x6K02T2Q125-51518604-51517675, MOR228-1, Olfr1267-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258204
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,683,128 bp
  • A to G, chromosome 1 at 55,194,259 bp
  • TC to T, chromosome 1 at 59,094,583 bp
  • C to G, chromosome 1 at 75,441,747 bp
  • T to A, chromosome 1 at 133,727,786 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • C to T, chromosome 2 at 3,464,421 bp
  • A to G, chromosome 2 at 28,548,436 bp
  • A to G, chromosome 2 at 87,645,323 bp
  • A to T, chromosome 2 at 90,085,609 bp
  • A to T, chromosome 2 at 111,369,049 bp
  • A to G, chromosome 2 at 119,035,395 bp
  • G to A, chromosome 2 at 180,191,662 bp
  • A to G, chromosome 3 at 34,054,303 bp
  • T to A, chromosome 3 at 73,701,800 bp
  • T to A, chromosome 3 at 83,128,534 bp
  • A to G, chromosome 3 at 87,735,852 bp
  • T to A, chromosome 3 at 90,268,779 bp
  • T to A, chromosome 4 at 35,709,566 bp
  • T to A, chromosome 4 at 43,855,206 bp
  • A to G, chromosome 4 at 128,383,950 bp
  • A to T, chromosome 4 at 151,991,560 bp
  • A to G, chromosome 5 at 92,940,936 bp
  • A to G, chromosome 6 at 67,760,340 bp
  • A to G, chromosome 6 at 121,775,809 bp
  • T to C, chromosome 7 at 46,435,292 bp
  • A to G, chromosome 7 at 92,567,735 bp
  • A to T, chromosome 7 at 104,348,130 bp
  • T to A, chromosome 8 at 24,684,664 bp
  • A to T, chromosome 9 at 39,144,210 bp
  • A to T, chromosome 9 at 44,404,388 bp
  • C to T, chromosome 9 at 45,896,105 bp
  • A to G, chromosome 9 at 51,848,592 bp
  • G to A, chromosome 9 at 53,247,907 bp
  • G to A, chromosome 9 at 109,194,727 bp
  • T to C, chromosome 10 at 21,144,966 bp
  • T to G, chromosome 10 at 62,281,131 bp
  • A to G, chromosome 11 at 49,444,342 bp
  • A to T, chromosome 11 at 120,456,824 bp
  • C to T, chromosome 13 at 32,728,410 bp
  • T to A, chromosome 13 at 33,157,824 bp
  • T to C, chromosome 14 at 8,083,717 bp
  • A to G, chromosome 16 at 20,735,747 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to G, chromosome 17 at 23,834,839 bp
  • A to G, chromosome 17 at 80,181,624 bp
  • T to A, chromosome 18 at 58,113,348 bp
  • G to A, chromosome 19 at 23,214,646 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6801 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044914-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.