Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6861Btlr/Mmmh
Stock Number:
044962-MU
Citation ID:
RRID:MMRRC_044962-MU
Other Names:
R6861 (G1)
Major Collection:

Strain Information

Irx3
Name: Iroquois related homeobox 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16373
Homologene: 7385
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Zfp97
Name: zinc finger protein 97
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22759
Homologene: 133884
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Adra2a
Name: adrenergic receptor, alpha 2a
Synonyms: alpha2A, alpha2A-adrenergic receptor, Adra-2a, Adra-2, alpha2A-AR, alpha(2A)AR
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11551
VEGA: 19
HGNC: HGNC:281
Homologene: 47944
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 74,925,115 bp
  • A to T, chromosome 1 at 140,100,883 bp
  • C to CTCTA, chromosome 2 at 25,579,721 bp
  • A to T, chromosome 2 at 38,740,585 bp
  • A to G, chromosome 2 at 52,195,720 bp
  • A to T, chromosome 2 at 69,513,377 bp
  • A to T, chromosome 2 at 120,705,186 bp
  • A to T, chromosome 2 at 156,525,222 bp
  • A to G, chromosome 2 at 157,152,967 bp
  • C to T, chromosome 3 at 22,191,439 bp
  • T to A, chromosome 3 at 22,191,539 bp
  • A to T, chromosome 3 at 76,322,216 bp
  • G to A, chromosome 3 at 95,680,884 bp
  • T to A, chromosome 3 at 98,622,012 bp
  • A to G, chromosome 3 at 98,877,182 bp
  • T to C, chromosome 3 at 100,969,625 bp
  • G to A, chromosome 3 at 114,167,492 bp
  • A to G, chromosome 3 at 136,255,003 bp
  • T to C, chromosome 3 at 144,970,655 bp
  • G to A, chromosome 3 at 145,460,834 bp
  • A to G, chromosome 4 at 48,672,214 bp
  • G to C, chromosome 4 at 60,004,093 bp
  • A to G, chromosome 4 at 127,970,726 bp
  • G to T, chromosome 4 at 141,859,881 bp
  • T to A, chromosome 5 at 24,435,009 bp
  • C to T, chromosome 5 at 107,748,318 bp
  • A to G, chromosome 5 at 115,611,049 bp
  • G to T, chromosome 5 at 138,304,707 bp
  • T to A, chromosome 5 at 145,370,963 bp
  • A to G, chromosome 5 at 149,265,117 bp
  • CC to CCCCATCAGGC, chromosome 6 at 4,756,350 bp
  • C to CCCATCAGGA, chromosome 6 at 4,756,351 bp
  • A to G, chromosome 6 at 18,268,108 bp
  • T to A, chromosome 6 at 48,487,955 bp
  • T to C, chromosome 6 at 132,980,085 bp
  • A to T, chromosome 7 at 4,241,932 bp
  • G to T, chromosome 7 at 6,711,386 bp
  • G to A, chromosome 7 at 80,098,218 bp
  • G to GACGGCGGCA, chromosome 7 at 97,579,909 bp
  • A to G, chromosome 7 at 118,743,675 bp
  • T to A, chromosome 7 at 119,144,652 bp
  • T to A, chromosome 7 at 124,396,829 bp
  • T to A, chromosome 7 at 134,771,478 bp
  • T to C, chromosome 8 at 3,682,910 bp
  • A to G, chromosome 8 at 85,066,111 bp
  • A to G, chromosome 8 at 91,798,902 bp
  • G to A, chromosome 8 at 94,521,229 bp
  • T to G, chromosome 8 at 95,062,397 bp
  • C to T, chromosome 8 at 120,026,113 bp
  • C to T, chromosome 9 at 21,205,301 bp
  • T to C, chromosome 9 at 38,449,435 bp
  • A to G, chromosome 9 at 42,337,337 bp
  • T to C, chromosome 9 at 65,358,622 bp
  • A to C, chromosome 9 at 119,530,023 bp
  • C to T, chromosome 10 at 79,541,156 bp
  • T to A, chromosome 10 at 82,379,114 bp
  • A to G, chromosome 11 at 3,715,191 bp
  • A to G, chromosome 11 at 45,933,954 bp
  • A to T, chromosome 11 at 49,494,805 bp
  • C to A, chromosome 11 at 69,455,963 bp
  • A to G, chromosome 11 at 103,116,967 bp
  • G to A, chromosome 11 at 107,062,565 bp
  • G to A, chromosome 12 at 61,839,690 bp
  • C to A, chromosome 12 at 75,909,266 bp
  • G to T, chromosome 12 at 83,774,949 bp
  • A to T, chromosome 13 at 74,189,200 bp
  • T to A, chromosome 13 at 119,699,999 bp
  • G to A, chromosome 14 at 12,522,401 bp
  • T to A, chromosome 14 at 29,970,048 bp
  • T to C, chromosome 14 at 46,832,328 bp
  • T to A, chromosome 14 at 63,819,644 bp
  • T to A, chromosome 15 at 35,576,395 bp
  • T to A, chromosome 15 at 66,688,891 bp
  • G to A, chromosome 15 at 99,772,363 bp
  • A to T, chromosome 16 at 58,926,504 bp
  • G to A, chromosome 16 at 90,963,880 bp
  • G to A, chromosome 17 at 5,327,686 bp
  • A to G, chromosome 17 at 17,145,175 bp
  • C to T, chromosome 17 at 75,227,192 bp
  • G to A, chromosome 18 at 67,841,628 bp
  • GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC to GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC, chromosome 18 at 74,273,574 bp
  • C to A, chromosome 18 at 80,974,375 bp
  • T to C, chromosome 19 at 5,971,810 bp
  • T to A, chromosome 19 at 10,585,337 bp
  • T to C, chromosome 19 at 54,046,387 bp
  • A to G, chromosome 19 at 55,742,523 bp
  • T to C, chromosome 19 at 56,901,593 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6861 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044962-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.