Strain Name:
C57BL/6J-MtgxR6861Btlr/Mmmh
Stock Number:
044962-MU
Citation ID:
RRID:MMRRC_044962-MU
Other Names:
R6861 (G1)
Major Collection:

Strain Information

Irx3
Name: Iroquois related homeobox 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16373
Homologene: 7385
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Zfp97
Name: zinc finger protein 97
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22759
Homologene: 133884
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Adra2a
Name: adrenergic receptor, alpha 2a
Synonyms: alpha2A, alpha2A-adrenergic receptor, Adra-2a, Adra-2, alpha2A-AR, alpha(2A)AR
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11551
VEGA: 19
HGNC: HGNC:281
Homologene: 47944
Gpr139
Name: G protein-coupled receptor 139
Synonyms: LOC209776, GPRg1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 209776
Homologene: 45860
Slc4a2
Name: solute carrier family 4 (anion exchanger), member 2
Synonyms: B3RP, Ae2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20535
Homologene: 128699
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71517
Homologene: 10659
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Tcf7l2
Name: transcription factor 7 like 2, T cell specific, HMG box
Synonyms: TCF4E, TCF4B, mTcf-4E, mTcf-4B, Tcf-4, Tcf4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21416
Homologene: 7564
Evi5
Name: ecotropic viral integration site 5
Synonyms: NB4S
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14020
HGNC: HGNC:3501
Homologene: 121902
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Tbl1xr1
Name: transducin (beta)-like 1X-linked receptor 1
Synonyms: Ira1, TBLR1, DC42, C21, C230089I12Rik, A630076E03Rik, 8030499H02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 81004
Homologene: 69382
Mbd1
Name: methyl-CpG binding domain protein 1
Synonyms: PCM1, Cxxc3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17190
VEGA: 18
HGNC: HGNC:6916
Homologene: 8414
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
Arid1b
Name: AT-rich interaction domain 1B
Synonyms: B230217J03Rik, 9330189K18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 239985
Homologene: 32344
Mier2
Name: MIER family member 2
Synonyms: 2700087H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70427
Homologene: 18941
Cftr
Name: cystic fibrosis transmembrane conductance regulator
Synonyms: Abcc7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12638
HGNC: HGNC:1884
Homologene: 55465
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Gm4924
Name: predicted gene 4924
Synonyms: mIF1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237412
Clca4a
Name: chloride channel accessory 4A
Synonyms: 9130020L07Rik, Clca6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99663
HGNC: HGNC:2018
Homologene: 40808
Crispld2
Name: cysteine-rich secretory protein LCCL domain containing 2
Synonyms: 1810049K24Rik, coffeecrisp, Lgl1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78892
Homologene: 41792
Rbl1
Name: RB transcriptional corepressor like 1
Synonyms: p107, retinoblastoma-like 1 (p107)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19650
HGNC: HGNC:9893
Homologene: 2172
Nr6a1
Name: nuclear receptor subfamily 6, group A, member 1
Synonyms: Gcnf, NCNF, 1700113M01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14536
HGNC: HGNC:7985
Homologene: 36308
Ttf2
Name: transcription termination factor, RNA polymerase II
Synonyms: 4632434F22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74044
Homologene: 37826
Hexim1
Name: hexamethylene bis-acetamide inducible 1
Synonyms: HIS1, CLP-1, 7330426E13Rik, Clp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192231
Homologene: 31382
Papln
Name: papilin, proteoglycan-like sulfated glycoprotein
Synonyms: E030033C16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 170721
Homologene: 71541
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Pde4a
Name: phosphodiesterase 4A, cAMP specific
Synonyms: dunce, Dpde2, D9Ertd60e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18577
HGNC: HGNC:8780
Homologene: 4520
Stag3
Name: STAG3 cohesin complex component
Synonyms: stromalin 3, SA-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50878
Homologene: 40844
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Selenok
Name: selenoprotein K
Synonyms: HSPC030, 30kDa, Selk
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 80795
Homologene: 56870
Idh2
Name: isocitrate dehydrogenase 2 (NADP+), mitochondrial
Synonyms: Idh-2, IDPm
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269951
HGNC: HGNC:5383
Homologene: 37590
Col24a1
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71355
Homologene: 65061
Fbxw9
Name: F-box and WD-40 domain protein 9
Synonyms: 1110017H11Rik, Fbw9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68628
Homologene: 23598
Sall3
Name: spalt like transcription factor 3
Synonyms: Msal, Msal-1, Spalt, Salt, B130022O04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20689
VEGA: 18
Homologene: 18142
Fcer2a
Name: Fc receptor, IgE, low affinity II, alpha polypeptide
Synonyms: low-affinity IgE receptor, FC epsilon RII, Fce2, Ly-42, CD23
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14128
HGNC: HGNC:3612
Homologene: 1517
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Fstl5
Name: follistatin-like 5
Synonyms: 9130207J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213262
Homologene: 10584
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Drc7
Name: dynein regulatory complex subunit 7
Synonyms: LOC330830, SRG-L, Ccdc135
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330830
Homologene: 12996
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5c, Nav1.5, mH1, SkM2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: N-3 kinesin, Kif16a, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
Osbp2
Name: oxysterol binding protein 2
Synonyms: OSBPL1, ORP-4, 1700095P05Rik, C630001G20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74309
HGNC: HGNC:8504
Homologene: 75303
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
Exoc3
Name: exocyst complex component 3
Synonyms: E430013E20Rik, Sec6l1, 2810050O03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 211446
VEGA: 13
Homologene: 38296
Alox5ap
Name: arachidonate 5-lipoxygenase activating protein
Synonyms: arachidonate 5 lipoxygenase activating protein, Flap
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11690
HGNC: HGNC:436
Homologene: 1231
Hsd3b5
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms: 3(beta)HSDV
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15496
Homologene: 104115
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241116
Homologene: 28093
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Adamtsl4
Name: ADAMTS-like 4
Synonyms: Tsrc1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229595
Homologene: 23141
Efhd2
Name: EF hand domain containing 2
Synonyms: 2600015J22Rik, D4Wsu27e, swiprosin 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27984
Homologene: 32580
Col11a1
Name: collagen, type XI, alpha 1
Synonyms: C530001D20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12814
HGNC: HGNC:2186
Homologene: 56389
CK137956
Name: cDNA sequence CK137956
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 635169
Homologene: 57187
Mup6
Name: major urinary protein 6
Synonyms: Gm12544
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 620807
Homologene: 74304
Hs3st4
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 4
Synonyms: Gm6915
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628779
HGNC: HGNC:5200
Homologene: 82444
Cyp3a57
Name: cytochrome P450, family 3, subfamily a, polypeptide 57
Synonyms: EG622127
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 622127
Homologene: 135775
Xkr6
Name: X-linked Kx blood group related 6
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219149
Homologene: 18287
Cgrrf1
Name: cell growth regulator with ring finger domain 1
Synonyms: 1110038G02Rik, CGR19, 1810009H17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68755
Homologene: 4789
Cers5
Name: ceramide synthase 5
Synonyms: Trh4, 2310081H14Rik, CerS5, Lass5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71949
Homologene: 23634
Synj1
Name: synaptojanin 1
Synonyms: A930006D20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104015
Homologene: 48252
Bank1
Name: B cell scaffold protein with ankyrin repeats 1
Synonyms: A530094C12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242248
Homologene: 9926
Cfh
Name: complement component factor h
Synonyms: Mud-1, Sas-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Slc22a20
Name: solute carrier family 22 (organic anion transporter), member 20
Synonyms: LOC381203, mOAT6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381203
Homologene: 87203
Lrfn5
Name: leucine rich repeat and fibronectin type III domain containing 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238205
Homologene: 17582
Or2y1
Name: olfactory receptor family 2 subfamily Y member 1
Synonyms: GA_x6K02T2QP88-5941817-5940888, MOR256-42P, MOR256-42P, MOR256-41P, Olfr1549-ps1, Olfr1385
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258027
Homologene: 86692
Ajm1
Name: apical junction component 1
Synonyms: LOC381353, Gm996
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381353
Homologene: 19943
Lilra5
Name: leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Synonyms: Gm4878
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232801
Homologene: 83297
Vwa2
Name: von Willebrand factor A domain containing 2
Synonyms: Amaco
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240675
Homologene: 18238
Or5k17
Name: olfactory receptor family 5 subfamily K member 17
Synonyms: GA_x54KRFPKG5P-55145984-55145034, MOR184-4, Olfr181
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259001
Homologene: 74112
Cyb561a3
Name: cytochrome b561 family, member A3
Synonyms: 2310004G04Rik, Cybasc3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225912
VEGA: 19
Homologene: 15558
Hao2
Name: hydroxyacid oxidase 2
Synonyms: Hao3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56185
HGNC: HGNC:4810
Homologene: 97412
Tas2r109
Name: taste receptor, type 2, member 109
Synonyms: T2R09, Tas2r9, mGR09, mt2r62
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387343
Homologene: 87292
Cavin4
Name: caveolae associated 4
Synonyms: 2310039E09Rik, cavin 4, Murc
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68016
Homologene: 12224
Lsm11
Name: U7 snRNP-specific Sm-like protein LSM11
Synonyms: 2210404M20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72290
Homologene: 32693
Or8b43
Name: olfactory receptor family 8 subfamily B member 43
Synonyms: GA_x6K02T2PVTD-32141623-32142552, MOR169-1, Olfr902
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258798
VEGA: 9
Hmgcs1
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1
Synonyms: B130032C06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208715
VEGA: 13
HGNC: HGNC:5007
Homologene: 1609
Pdcd7
Name: programmed cell death 7
Synonyms: ES18
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50996
VEGA: 9
HGNC: HGNC:8767
Homologene: 4170
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 74,925,115 bp
  • A to T, chromosome 1 at 140,100,883 bp
  • C to CTCTA, chromosome 2 at 25,579,721 bp
  • A to T, chromosome 2 at 38,740,585 bp
  • A to G, chromosome 2 at 52,195,720 bp
  • A to T, chromosome 2 at 69,513,377 bp
  • A to T, chromosome 2 at 120,705,186 bp
  • A to T, chromosome 2 at 156,525,222 bp
  • A to G, chromosome 2 at 157,152,967 bp
  • C to T, chromosome 3 at 22,191,439 bp
  • T to A, chromosome 3 at 22,191,539 bp
  • A to T, chromosome 3 at 76,322,216 bp
  • G to A, chromosome 3 at 95,680,884 bp
  • T to A, chromosome 3 at 98,622,012 bp
  • A to G, chromosome 3 at 98,877,182 bp
  • T to C, chromosome 3 at 100,969,625 bp
  • G to A, chromosome 3 at 114,167,492 bp
  • A to G, chromosome 3 at 136,255,003 bp
  • T to C, chromosome 3 at 144,970,655 bp
  • G to A, chromosome 3 at 145,460,834 bp
  • A to G, chromosome 4 at 48,672,214 bp
  • G to C, chromosome 4 at 60,004,093 bp
  • A to G, chromosome 4 at 127,970,726 bp
  • G to T, chromosome 4 at 141,859,881 bp
  • T to A, chromosome 5 at 24,435,009 bp
  • C to T, chromosome 5 at 107,748,318 bp
  • A to G, chromosome 5 at 115,611,049 bp
  • G to T, chromosome 5 at 138,304,707 bp
  • T to A, chromosome 5 at 145,370,963 bp
  • A to G, chromosome 5 at 149,265,117 bp
  • CC to CCCCATCAGGC, chromosome 6 at 4,756,350 bp
  • C to CCCATCAGGA, chromosome 6 at 4,756,351 bp
  • A to G, chromosome 6 at 18,268,108 bp
  • T to A, chromosome 6 at 48,487,955 bp
  • T to C, chromosome 6 at 132,980,085 bp
  • A to T, chromosome 7 at 4,241,932 bp
  • G to T, chromosome 7 at 6,711,386 bp
  • G to A, chromosome 7 at 80,098,218 bp
  • G to GACGGCGGCA, chromosome 7 at 97,579,909 bp
  • A to G, chromosome 7 at 118,743,675 bp
  • T to A, chromosome 7 at 119,144,652 bp
  • T to A, chromosome 7 at 124,396,829 bp
  • T to A, chromosome 7 at 134,771,478 bp
  • T to C, chromosome 8 at 3,682,910 bp
  • A to G, chromosome 8 at 85,066,111 bp
  • A to G, chromosome 8 at 91,798,902 bp
  • G to A, chromosome 8 at 94,521,229 bp
  • T to G, chromosome 8 at 95,062,397 bp
  • C to T, chromosome 8 at 120,026,113 bp
  • C to T, chromosome 9 at 21,205,301 bp
  • T to C, chromosome 9 at 38,449,435 bp
  • A to G, chromosome 9 at 42,337,337 bp
  • T to C, chromosome 9 at 65,358,622 bp
  • A to C, chromosome 9 at 119,530,023 bp
  • C to T, chromosome 10 at 79,541,156 bp
  • T to A, chromosome 10 at 82,379,114 bp
  • A to G, chromosome 11 at 3,715,191 bp
  • A to G, chromosome 11 at 45,933,954 bp
  • A to T, chromosome 11 at 49,494,805 bp
  • C to A, chromosome 11 at 69,455,963 bp
  • A to G, chromosome 11 at 103,116,967 bp
  • G to A, chromosome 11 at 107,062,565 bp
  • G to A, chromosome 12 at 61,839,690 bp
  • C to A, chromosome 12 at 75,909,266 bp
  • G to T, chromosome 12 at 83,774,949 bp
  • A to T, chromosome 13 at 74,189,200 bp
  • T to A, chromosome 13 at 119,699,999 bp
  • G to A, chromosome 14 at 12,522,401 bp
  • T to A, chromosome 14 at 29,970,048 bp
  • T to C, chromosome 14 at 46,832,328 bp
  • T to A, chromosome 14 at 63,819,644 bp
  • T to A, chromosome 15 at 35,576,395 bp
  • T to A, chromosome 15 at 66,688,891 bp
  • G to A, chromosome 15 at 99,772,363 bp
  • A to T, chromosome 16 at 58,926,504 bp
  • G to A, chromosome 16 at 90,963,880 bp
  • G to A, chromosome 17 at 5,327,686 bp
  • A to G, chromosome 17 at 17,145,175 bp
  • C to T, chromosome 17 at 75,227,192 bp
  • G to A, chromosome 18 at 67,841,628 bp
  • GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC to GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC, chromosome 18 at 74,273,574 bp
  • C to A, chromosome 18 at 80,974,375 bp
  • T to C, chromosome 19 at 5,971,810 bp
  • T to A, chromosome 19 at 10,585,337 bp
  • T to C, chromosome 19 at 54,046,387 bp
  • A to G, chromosome 19 at 55,742,523 bp
  • T to C, chromosome 19 at 56,901,593 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6861 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044962-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.