Strain Name:
C57BL/6J-MtgxR6980Btlr/Mmmh
Stock Number:
045088-MU
Citation ID:
RRID:MMRRC_045088-MU
Other Names:
R6980 (G1)
Major Collection:

Strain Information

Ifngr2
Name: interferon gamma receptor 2
Synonyms: Ifgr2, Ifgt
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15980
HGNC: HGNC:5440
Homologene: 4041
Chat
Name: choline acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 1100001C18Rik, A330076K04Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 9030227G01Rik, 2510002A14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78798
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Rnf40
Name: ring finger protein 40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233900
Homologene: 8856
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: 2310065E01Rik, 9530001P15Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Mdn1
Name: midasin AAA ATPase 1
Synonyms: 4833432B22Rik, D4Abb1e, LOC213784
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
E130308A19Rik
Name: RIKEN cDNA E130308A19 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230259
Homologene: 136157
Cmas
Name: cytidine monophospho-N-acetylneuraminic acid synthetase
Synonyms: D6Bwg0250e, CMP-sialic acid synthetase, CMP-Neu5Ac synthase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12764
Homologene: 7670
Zfp318
Name: zinc finger protein 318
Synonyms: 2610034E08Rik, TZF, D530032D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57908
Homologene: 22808
Rsbn1l
Name: round spermatid basic protein 1-like
Synonyms: C330002G24Rik, 8430412F05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242860
Homologene: 19435
Pms2
Name: PMS1 homolog2, mismatch repair system component
Synonyms: mismatch repair, DNA mismatch repair
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18861
Homologene: 133560
Gfpt1
Name: glutamine fructose-6-phosphate transaminase 1
Synonyms: GFAT1, GFA, GFAT, 2810423A18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14583
HGNC: HGNC:4241
Homologene: 68220
Runx2
Name: runt related transcription factor 2
Synonyms: Pebpa2a, SL3-3 enhancer factor 1, Osf2, PEBP2aA, PEBP2 alpha A, AML3, polyomavirus enhancer binding factor 2 (PEBP2), Cbfa1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12393
Homologene: 68389
Pamr1
Name: peptidase domain containing associated with muscle regeneration 1
Synonyms: RAMP, E430002G05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 210622
Homologene: 9134
Abcf2
Name: ATP-binding cassette, sub-family F member 2
Synonyms: Drr3, 0710005O05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27407
Homologene: 21408
Ift172
Name: intraflagellar transport 172
Synonyms: wim, 4930553F24Rik, avc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67661
Homologene: 15202
Sdc3
Name: syndecan 3
Synonyms: Synd3, syn-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20970
Homologene: 7965
Ptpn4
Name: protein tyrosine phosphatase, non-receptor type 4
Synonyms: testis-enriched phosphatase, hPTP-MEG, PTPMEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), TEP, TEP/mPTPMEG
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19258
HGNC: HGNC:9656
Homologene: 2120
Pfdn2
Name: prefoldin 2
Synonyms: W48336, ESTM27
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18637
HGNC: HGNC:8867
Homologene: 7887
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: Ryr, calcium release channel isoform 1, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, SCA6, Ccha1a, nmf352, smrl, alpha1A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Tgm3
Name: transglutaminase 3, E polypeptide
Synonyms: we, TG E
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21818
Homologene: 20690
Ell2
Name: elongation factor for RNA polymerase II 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 192657
VEGA: 13
Homologene: 8094
Eif4e1b
Name: eukaryotic translation initiation factor 4E family member 1B
Synonyms: Eif4eloo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218268
Homologene: 100945
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hyrh, 1700034M11Rik, hy3, 4930545D19Rik, hy-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Cfap74
Name: cilia and flagella associated protein 74
Synonyms: 2010015L04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 544678
Homologene: 129584
Ttn
Name: titin
Synonyms: connectin, 1100001C23Rik, D330041I19Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, 2310057K23Rik, shru, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Mroh7
Name: maestro heat-like repeat family member 7
Synonyms: Gm1027, LOC381538, Heatr8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381538
Homologene: 19633
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9030411M15Rik, 9430028L06Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Rusc2
Name: RUN and SH3 domain containing 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100213
Homologene: 18967
Tmem116
Name: transmembrane protein 116
Synonyms: 4930513P12Rik, 4930406A18Rik, C030022K24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77462
Homologene: 12676
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: Gm980, Dnahc14, A230079K17Rik, LOC381311
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
D130043K22Rik
Name: RIKEN cDNA D130043K22 gene
Synonyms: Kiaa0319
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210108
Homologene: 8878
Hfm1
Name: HFM1, ATP-dependent DNA helicase homolog
Synonyms: A330009G12Rik, LOC381663, Mer3, Sec63d1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330149
Homologene: 87103
Tmem132e
Name: transmembrane protein 132E
Synonyms: LOC270893
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 270893
Homologene: 41524
Gm5114
Name: predicted gene 5114
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330513
Homologene: 45597
Gpr179
Name: G protein-coupled receptor 179
Synonyms: 5330439C02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217143
Homologene: 34917
Unc79
Name: unc-79 homolog
Synonyms: Mlca3, 9030205A07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Ugt2a3
Name: UDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms: 2010321J07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72094
Homologene: 55988
Gramd4
Name: GRAM domain containing 4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223752
Homologene: 18199
Slc25a39
Name: solute carrier family 25, member 39
Synonyms: 3010027G13Rik, D11Ertd333e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68066
Homologene: 69200
Abhd18
Name: abhydrolase domain containing 18
Synonyms: 3110057O12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269423
Homologene: 105457
Sik2
Name: salt inducible kinase 2
Synonyms: G630080D20Rik, Snf1lk2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235344
Homologene: 22875
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Dcdc4, Rp1hl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Trp63
Name: transformation related protein 63
Synonyms: deltaNp63, KET protein, p51/p63, Trp53rp1, TAp63, p63, p73L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22061
Homologene: 31189
Dtx1
Name: deltex 1, E3 ubiquitin ligase
Synonyms: Fxit1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14357
HGNC: HGNC:3060
Homologene: 74522
Ccdc178
Name: coiled coil domain containing 178
Synonyms: 4921528I01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70950
VEGA: 18
Homologene: 12373
Abca2
Name: ATP-binding cassette, sub-family A member 2
Synonyms: D2H0S1474E, Abc2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11305
HGNC: HGNC:32
Homologene: 55590
Vmn2r58
Name: vomeronasal 2, receptor 58
Synonyms: EG628422
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628422
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Vmn2r7
Name: vomeronasal 2, receptor 7
Synonyms: 4933425M15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319217
Homologene: 129754
Adrb1
Name: adrenergic receptor, beta 1
Synonyms: Adrb-1, beta 1-AR
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11554
VEGA: 19
HGNC: HGNC:285
Homologene: 20171
Megf11
Name: multiple EGF-like-domains 11
Synonyms: 2410080H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214058
Homologene: 13031
Spdl1
Name: spindle apparatus coiled-coil protein 1
Synonyms: 2600001J17Rik, 2810049B11Rik, Ccdc99, 1700018I02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70385
Homologene: 9837
Or5al6
Name: olfactory receptor family 5 subfamily AL member 6
Synonyms: MOR185-12, Olfr1040, GA_x6K02T2Q125-47615732-47614791
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404323
Homologene: 79382
Dzank1
Name: double zinc ribbon and ankyrin repeat domains 1
Synonyms: 6330439K17Rik, Ankrd64, 2810039F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241688
Homologene: 10037
Mixl1
Name: Mix paired-like homeobox
Synonyms: Mml
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27217
Homologene: 8445
Oxnad1
Name: oxidoreductase NAD-binding domain containing 1
Synonyms: 2410002F01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218885
Homologene: 16303
Tubgcp4
Name: tubulin, gamma complex component 4
Synonyms: D2Ertd435e, 4932441P04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51885
Homologene: 8690
Mpp2
Name: membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Synonyms: Dlg2, Pals4, D11Bwg0652e, Dlgh2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50997
HGNC: HGNC:7220
Homologene: 3920
Or4g17
Name: olfactory receptor family 4 subfamily G member 17
Synonyms: MOR245-13, Olfr1284, GA_x6K02T2Q125-72430580-72431515
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258379
Homologene: 74059
Trcg1
Name: taste receptor cell gene 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 541610
Homologene: 134171
Cyb561d1
Name: cytochrome b-561 domain containing 1
Synonyms: 1600010M23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72023
Homologene: 45651
Pdlim7
Name: PDZ and LIM domain 7
Synonyms: 1110003B01Rik, Enigma, 2410002J21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67399
Homologene: 3980
Snai2
Name: snail family zinc finger 2
Synonyms: Snail2, Slug, Slugh
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20583
VEGA: 16
Homologene: 31127
Scgb3a2
Name: secretoglobin, family 3A, member 2
Synonyms: UGRP1, LuLeu1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 117158
Homologene: 14274
Cbx8
Name: chromobox 8
Synonyms: Pc3, polycomb 3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30951
Homologene: 32199
Dnajb3
Name: DnaJ heat shock protein family (Hsp40) member B3
Synonyms: MSJ-1, Hsj3, Msj1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15504
Homologene: 56409
Gpr15
Name: G protein-coupled receptor 15
Synonyms: 4933439K08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71223
VEGA: 16
HGNC: HGNC:4469
Homologene: 3869
Art2b
Name: ADP-ribosyltransferase 2b
Synonyms: Rt6-2, Rt6, ART2.2, Rt-6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11872
Homologene: 113756
Tmem53
Name: transmembrane protein 53
Synonyms: 1110038M16Rik, 1700012A05Rik, 1500001P22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68777
Homologene: 41573
Mrgpra6
Name: MAS-related GPR, member A6
Synonyms: MrgA6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381886
Or52e19b
Name: olfactory receptor family 52 subfamily E member 19B
Synonyms: GA_x6K02T2PBJ9-6092550-6092362, Olfr603, GA_x6K02T2PBJ9-6096387-6095449, Olfr604, MOR32-14_i, MOR32-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259073
Homologene: 121535
Kdf1
Name: keratinocyte differentiation factor 1
Synonyms: 1810019J16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69073
Homologene: 17563
Pcdhgb5
Name: protocadherin gamma subfamily B, 5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93702
HGNC: HGNC:8712
Homologene: 55773
Spata31d1b
Name: spermatogenesis associated 31 subfamily D, member 1B
Synonyms: Gm4934, Fam75d1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238662
VEGA: 13
D030056L22Rik
Name: RIKEN cDNA D030056L22 gene
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225995
VEGA: 19
Homologene: 49520
Cdhr17
Name: cadherin related family member 17
Synonyms: Gm28710
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 102640594
Homologene: 141132
Or4p4b-ps1
Name: olfactory receptor family 4 subfamily P member 4B, pseudogene 1
Synonyms: GA_x6K02T2PRF0-25008-25939, Olfr475-ps1, MOR225-17_p
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404395
Gm49355
Name: predicted gene, 49355
Type: Gene
Species: Mouse
Chromosome: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 11,162,263 bp
  • T to G, chromosome 1 at 88,205,014 bp
  • T to A, chromosome 1 at 119,743,421 bp
  • C to T, chromosome 1 at 171,357,897 bp
  • G to A, chromosome 1 at 180,696,888 bp
  • T to C, chromosome 1 at 181,648,230 bp
  • C to A, chromosome 2 at 25,440,866 bp
  • C to T, chromosome 2 at 76,879,057 bp
  • A to T, chromosome 2 at 86,146,337 bp
  • A to G, chromosome 2 at 88,623,595 bp
  • C to T, chromosome 2 at 102,642,204 bp
  • A to G, chromosome 2 at 111,379,275 bp
  • T to C, chromosome 2 at 121,195,465 bp
  • T to A, chromosome 2 at 130,026,777 bp
  • C to T, chromosome 2 at 144,490,136 bp
  • G to A, chromosome 3 at 40,933,780 bp
  • G to A, chromosome 3 at 64,716,566 bp
  • A to T, chromosome 3 at 90,119,927 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC to ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC, chromosome 3 at 95,888,139 bp
  • CACTGGTTCTGTGGT to CACTGGTTCTGTGGTTACTGGTTCTGTGGT, chromosome 3 at 95,888,168 bp
  • A to T, chromosome 3 at 108,200,159 bp
  • G to A, chromosome 4 at 32,726,942 bp
  • A to G, chromosome 4 at 43,422,846 bp
  • A to C, chromosome 4 at 59,719,991 bp
  • T to A, chromosome 4 at 106,700,237 bp
  • T to C, chromosome 4 at 117,268,508 bp
  • T to A, chromosome 4 at 130,816,922 bp
  • A to T, chromosome 4 at 133,528,827 bp
  • G to A, chromosome 4 at 155,466,352 bp
  • T to A, chromosome 5 at 16,826,946 bp
  • T to A, chromosome 5 at 20,896,484 bp
  • T to C, chromosome 5 at 24,565,972 bp
  • T to C, chromosome 5 at 31,257,386 bp
  • A to T, chromosome 5 at 73,050,430 bp
  • A to C, chromosome 5 at 87,325,632 bp
  • A to T, chromosome 5 at 106,880,477 bp
  • T to C, chromosome 5 at 120,681,357 bp
  • T to C, chromosome 5 at 121,467,987 bp
  • A to T, chromosome 5 at 143,912,024 bp
  • C to A, chromosome 6 at 87,077,089 bp
  • A to G, chromosome 6 at 142,756,800 bp
  • T to A, chromosome 7 at 29,109,387 bp
  • T to C, chromosome 7 at 39,409,200 bp
  • T to C, chromosome 7 at 41,864,238 bp
  • A to G, chromosome 7 at 47,188,949 bp
  • T to C, chromosome 7 at 101,580,473 bp
  • T to C, chromosome 7 at 103,383,096 bp
  • T to A, chromosome 7 at 127,594,677 bp
  • A to G, chromosome 8 at 84,612,285 bp
  • A to T, chromosome 8 at 110,413,284 bp
  • A to G, chromosome 9 at 50,897,455 bp
  • A to C, chromosome 9 at 57,245,573 bp
  • A to G, chromosome 9 at 64,705,850 bp
  • T to C, chromosome 10 at 8,729,848 bp
  • A to T, chromosome 11 at 34,830,879 bp
  • T to A, chromosome 11 at 82,438,386 bp
  • T to C, chromosome 11 at 97,334,858 bp
  • A to G, chromosome 11 at 102,059,328 bp
  • A to G, chromosome 11 at 102,405,775 bp
  • A to T, chromosome 11 at 119,039,461 bp
  • G to A, chromosome 12 at 103,059,500 bp
  • G to T, chromosome 13 at 24,864,781 bp
  • T to A, chromosome 13 at 54,784,103 bp
  • G to T, chromosome 13 at 55,508,228 bp
  • A to T, chromosome 13 at 59,715,422 bp
  • A to G, chromosome 13 at 75,756,376 bp
  • C to T, chromosome 13 at 102,804,647 bp
  • T to C, chromosome 14 at 12,307,173 bp
  • C to T, chromosome 14 at 32,085,619 bp
  • A to T, chromosome 14 at 32,424,154 bp
  • A to G, chromosome 14 at 64,028,720 bp
  • A to G, chromosome 15 at 86,131,969 bp
  • T to A, chromosome 16 at 14,708,249 bp
  • T to A, chromosome 16 at 25,802,093 bp
  • T to A, chromosome 16 at 58,718,742 bp
  • T to A, chromosome 16 at 91,560,007 bp
  • C to T, chromosome 17 at 44,735,316 bp
  • T to A, chromosome 17 at 46,397,212 bp
  • G to A, chromosome 17 at 83,451,017 bp
  • T to A, chromosome 18 at 22,105,563 bp
  • C to T, chromosome 18 at 37,733,539 bp
  • T to A, chromosome 18 at 43,764,434 bp
  • T to A, chromosome 18 at 63,082,961 bp
  • A to G, chromosome 19 at 6,450,579 bp
  • A to T, chromosome 19 at 18,717,265 bp
  • A to T, chromosome 19 at 40,327,616 bp
  • A to G, chromosome 19 at 41,890,143 bp
  • G to T, chromosome 19 at 56,723,614 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6980 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045088-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.