Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6980Btlr/Mmmh
Stock Number:
045088-MU
Citation ID:
RRID:MMRRC_045088-MU
Other Names:
R6980 (G1)
Major Collection:

Strain Information

Ifngr2
Name: interferon gamma receptor 2
Synonyms: Ifgt, Ifgr2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15980
HGNC: HGNC:5440
Homologene: 4041
Chat
Name: choline O-acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78798
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 11,162,263 bp
  • T to G, chromosome 1 at 88,205,014 bp
  • T to A, chromosome 1 at 119,743,421 bp
  • C to T, chromosome 1 at 171,357,897 bp
  • G to A, chromosome 1 at 180,696,888 bp
  • T to C, chromosome 1 at 181,648,230 bp
  • C to A, chromosome 2 at 25,440,866 bp
  • C to T, chromosome 2 at 76,879,057 bp
  • A to T, chromosome 2 at 86,146,337 bp
  • A to G, chromosome 2 at 88,623,595 bp
  • C to T, chromosome 2 at 102,642,204 bp
  • A to G, chromosome 2 at 111,379,275 bp
  • T to C, chromosome 2 at 121,195,465 bp
  • T to A, chromosome 2 at 130,026,777 bp
  • C to T, chromosome 2 at 144,490,136 bp
  • G to A, chromosome 3 at 40,933,780 bp
  • G to A, chromosome 3 at 64,716,566 bp
  • A to T, chromosome 3 at 90,119,927 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC to ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC, chromosome 3 at 95,888,139 bp
  • CACTGGTTCTGTGGT to CACTGGTTCTGTGGTTACTGGTTCTGTGGT, chromosome 3 at 95,888,168 bp
  • A to T, chromosome 3 at 108,200,159 bp
  • G to A, chromosome 4 at 32,726,942 bp
  • A to G, chromosome 4 at 43,422,846 bp
  • A to C, chromosome 4 at 59,719,991 bp
  • T to A, chromosome 4 at 106,700,237 bp
  • T to C, chromosome 4 at 117,268,508 bp
  • T to A, chromosome 4 at 130,816,922 bp
  • A to T, chromosome 4 at 133,528,827 bp
  • G to A, chromosome 4 at 155,466,352 bp
  • T to A, chromosome 5 at 16,826,946 bp
  • T to A, chromosome 5 at 20,896,484 bp
  • T to C, chromosome 5 at 24,565,972 bp
  • T to C, chromosome 5 at 31,257,386 bp
  • A to T, chromosome 5 at 73,050,430 bp
  • A to C, chromosome 5 at 87,325,632 bp
  • A to T, chromosome 5 at 106,880,477 bp
  • T to C, chromosome 5 at 120,681,357 bp
  • T to C, chromosome 5 at 121,467,987 bp
  • A to T, chromosome 5 at 143,912,024 bp
  • C to A, chromosome 6 at 87,077,089 bp
  • A to G, chromosome 6 at 142,756,800 bp
  • T to A, chromosome 7 at 29,109,387 bp
  • T to C, chromosome 7 at 39,409,200 bp
  • T to C, chromosome 7 at 41,864,238 bp
  • A to G, chromosome 7 at 47,188,949 bp
  • T to C, chromosome 7 at 101,580,473 bp
  • T to C, chromosome 7 at 103,383,096 bp
  • T to A, chromosome 7 at 127,594,677 bp
  • A to G, chromosome 8 at 84,612,285 bp
  • A to T, chromosome 8 at 110,413,284 bp
  • A to G, chromosome 9 at 50,897,455 bp
  • A to C, chromosome 9 at 57,245,573 bp
  • A to G, chromosome 9 at 64,705,850 bp
  • T to C, chromosome 10 at 8,729,848 bp
  • A to T, chromosome 11 at 34,830,879 bp
  • T to A, chromosome 11 at 82,438,386 bp
  • T to C, chromosome 11 at 97,334,858 bp
  • A to G, chromosome 11 at 102,059,328 bp
  • A to G, chromosome 11 at 102,405,775 bp
  • A to T, chromosome 11 at 119,039,461 bp
  • G to A, chromosome 12 at 103,059,500 bp
  • G to T, chromosome 13 at 24,864,781 bp
  • T to A, chromosome 13 at 54,784,103 bp
  • G to T, chromosome 13 at 55,508,228 bp
  • A to T, chromosome 13 at 59,715,422 bp
  • A to G, chromosome 13 at 75,756,376 bp
  • C to T, chromosome 13 at 102,804,647 bp
  • T to C, chromosome 14 at 12,307,173 bp
  • C to T, chromosome 14 at 32,085,619 bp
  • A to T, chromosome 14 at 32,424,154 bp
  • A to G, chromosome 14 at 64,028,720 bp
  • A to G, chromosome 15 at 86,131,969 bp
  • T to A, chromosome 16 at 14,708,249 bp
  • T to A, chromosome 16 at 25,802,093 bp
  • T to A, chromosome 16 at 58,718,742 bp
  • T to A, chromosome 16 at 91,560,007 bp
  • C to T, chromosome 17 at 44,735,316 bp
  • T to A, chromosome 17 at 46,397,212 bp
  • G to A, chromosome 17 at 83,451,017 bp
  • T to A, chromosome 18 at 22,105,563 bp
  • C to T, chromosome 18 at 37,733,539 bp
  • T to A, chromosome 18 at 43,764,434 bp
  • T to A, chromosome 18 at 63,082,961 bp
  • A to G, chromosome 19 at 6,450,579 bp
  • A to T, chromosome 19 at 18,717,265 bp
  • A to T, chromosome 19 at 40,327,616 bp
  • A to G, chromosome 19 at 41,890,143 bp
  • G to T, chromosome 19 at 56,723,614 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6980 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045088-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.