Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6991Btlr/Mmmh
Stock Number:
045097-MU
Citation ID:
RRID:MMRRC_045097-MU
Other Names:
R6991 (G1)
Major Collection:

Strain Information

Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Mapk8
Name: mitogen-activated protein kinase 8
Synonyms: JNK1, c-Jun N-terminal kinase, Prkm8
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26419
HGNC: HGNC:6881
Homologene: 56760
Wdr73
Name: WD repeat domain 73
Synonyms: 1200011I23Rik, 2410008B13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71968
Homologene: 41899
Rarg
Name: retinoic acid receptor, gamma
Synonyms: RARgamma2, RAR gamma 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19411
HGNC: HGNC:9866
Homologene: 20263
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,061,941 bp
  • T to A, chromosome 1 at 84,476,402 bp
  • T to A, chromosome 1 at 87,407,136 bp
  • T to A, chromosome 1 at 172,631,657 bp
  • T to C, chromosome 1 at 180,179,068 bp
  • G to A, chromosome 2 at 26,430,486 bp
  • T to C, chromosome 2 at 85,608,248 bp
  • G to A, chromosome 2 at 87,810,443 bp
  • C to T, chromosome 2 at 121,208,040 bp
  • G to A, chromosome 2 at 135,910,194 bp
  • C to A, chromosome 2 at 181,148,628 bp
  • T to A, chromosome 3 at 98,876,752 bp
  • T to C, chromosome 3 at 121,532,165 bp
  • C to T, chromosome 4 at 28,821,489 bp
  • A to G, chromosome 4 at 43,447,006 bp
  • G to A, chromosome 4 at 138,880,675 bp
  • A to G, chromosome 4 at 141,685,250 bp
  • T to A, chromosome 5 at 93,484,374 bp
  • T to A, chromosome 5 at 109,293,314 bp
  • G to A, chromosome 6 at 23,002,687 bp
  • G to T, chromosome 6 at 57,322,884 bp
  • A to G, chromosome 6 at 120,510,169 bp
  • G to A, chromosome 7 at 25,917,355 bp
  • T to A, chromosome 7 at 27,580,446 bp
  • T to G, chromosome 7 at 80,891,856 bp
  • T to G, chromosome 7 at 85,155,745 bp
  • T to C, chromosome 7 at 105,056,564 bp
  • T to A, chromosome 7 at 108,346,088 bp
  • C to A, chromosome 7 at 118,167,868 bp
  • A to T, chromosome 8 at 9,971,098 bp
  • C to A, chromosome 8 at 34,834,493 bp
  • A to G, chromosome 8 at 63,355,381 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 9 at 21,287,754 bp
  • T to A, chromosome 9 at 65,508,675 bp
  • T to C, chromosome 9 at 108,983,919 bp
  • T to C, chromosome 9 at 110,494,622 bp
  • G to T, chromosome 10 at 4,357,122 bp
  • T to C, chromosome 10 at 5,813,384 bp
  • T to C, chromosome 10 at 103,187,458 bp
  • A to C, chromosome 11 at 29,514,486 bp
  • A to G, chromosome 11 at 95,511,418 bp
  • A to C, chromosome 11 at 99,145,304 bp
  • G to A, chromosome 11 at 106,239,144 bp
  • A to G, chromosome 12 at 85,087,391 bp
  • T to C, chromosome 12 at 103,853,833 bp
  • T to A, chromosome 13 at 9,551,860 bp
  • C to T, chromosome 13 at 9,634,832 bp
  • T to A, chromosome 13 at 17,554,380 bp
  • ACTTCTTCT to ACTTCT, chromosome 13 at 59,649,576 bp
  • C to T, chromosome 13 at 67,708,521 bp
  • C to T, chromosome 13 at 102,804,647 bp
  • T to C, chromosome 14 at 33,410,884 bp
  • A to T, chromosome 14 at 34,593,907 bp
  • A to G, chromosome 15 at 8,252,206 bp
  • C to G, chromosome 15 at 102,241,915 bp
  • A to G, chromosome 16 at 92,397,363 bp
  • A to G, chromosome 17 at 19,378,110 bp
  • A to C, chromosome 17 at 24,658,055 bp
  • G to T, chromosome 17 at 34,584,800 bp
  • A to G, chromosome 17 at 56,771,345 bp
  • A to G, chromosome 17 at 74,562,095 bp
  • A to G, chromosome 17 at 79,621,310 bp
  • A to T, chromosome 18 at 43,353,891 bp
  • G to T, chromosome 19 at 12,680,748 bp
  • A to G, chromosome 19 at 29,719,108 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6991 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045097-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.