Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6991Btlr/Mmmh
Stock Number:
045097-MU
Citation ID:
RRID:MMRRC_045097-MU
Other Names:
R6991 (G1)
Major Collection:

Strain Information

Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Mapk8
Name: mitogen-activated protein kinase 8
Synonyms: JNK1, c-Jun N-terminal kinase, Prkm8
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26419
HGNC: HGNC:6881
Homologene: 56760
Wdr73
Name: WD repeat domain 73
Synonyms: 1200011I23Rik, 2410008B13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71968
Homologene: 41899
Rarg
Name: retinoic acid receptor, gamma
Synonyms: RARgamma2, RAR gamma 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19411
HGNC: HGNC:9866
Homologene: 20263
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Tnks
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms: 4930554K12Rik, D130072O21Rik, tankyrase 1, TANK1, mTNKS1, Parp5a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21951
Homologene: 18405
Ddx42
Name: DEAD box helicase 42
Synonyms: B430002H05Rik, 1810047H21Rik, SF3b125, DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72047
Homologene: 49137
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Sec16a
Name: SEC16 homolog A, endoplasmic reticulum export factor
Synonyms: C230052J16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227648
Homologene: 10533
Akap12
Name: A kinase anchor protein 12
Synonyms: SSeCKS, Tsga12, Srcs5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83397
VEGA: 10
HGNC: HGNC:370
Homologene: 3740
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Rcan1
Name: regulator of calcineurin 1
Synonyms: MCIP1, 2410048A02Rik, ADAPT78, CSP1, Dscr1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 54720
VEGA: 16
HGNC: HGNC:3040
Homologene: 3251
Ddi2
Name: DNA-damage inducible protein 2
Synonyms: 9130022E05Rik, 1110056G13Rik, 1700027M01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68817
Homologene: 121661
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: A830080H02Rik, 2610016F01Rik, Tnrc15
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227331
Homologene: 41048
Lig4
Name: ligase IV, DNA, ATP-dependent
Synonyms: DNA ligase IV, 5830471N16Rik, tiny
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319583
HGNC: HGNC:6601
Homologene: 1736
Zfp65
Name: zinc finger protein 65
Synonyms: KRAB5, Zfp71-rs1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 235907
Homologene: 87875
Golm1
Name: golgi membrane protein 1
Synonyms: D030064E01Rik, PSEC0257, GP73, 2310001L02Rik, Golph2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105348
VEGA: 13
Homologene: 12346
Slc44a3
Name: solute carrier family 44, member 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213603
Homologene: 64830
Opn4
Name: opsin 4 (melanopsin)
Synonyms: 1110007J02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30044
VEGA: 14
Homologene: 69152
Ccr7
Name: C-C motif chemokine receptor 7
Synonyms: EBI1, Ebi1h, CD197, Cmkbr7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12775
HGNC: HGNC:1608
Homologene: 1387
Dpysl3
Name: dihydropyrimidinase-like 3
Synonyms: Ulip1, Ulip, CRMP-4, TUC4, 9430041P20Rik, CRMP4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 22240
HGNC: HGNC:3015
Homologene: 20361
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Tesk1
Name: testis specific protein kinase 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21754
Homologene: 4577
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: BET, A930026D19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227325
Homologene: 26722
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Brd10
Name: bromodomain containing 10
Synonyms: Gm9832, 9930021J03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240613
Homologene: 19046
Sugct
Name: succinyl-CoA glutarate-CoA transferase
Synonyms: 5033411D12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 192136
VEGA: 13
Homologene: 11681
Vmn2r15
Name: vomeronasal 2, receptor 15
Synonyms: EG211223
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211223
Homologene: 129606
Cyp2b10
Name: cytochrome P450, family 2, subfamily b, polypeptide 10
Synonyms: p16, Cyp2b, phenobarbitol inducible, type b, Cyp2b20
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13088
HGNC: HGNC:2615
Homologene: 73894
Spock3
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonyms: testican 3, 2900045C01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72902
Homologene: 9662
Mtrf1l
Name: mitochondrial translational release factor 1-like
Synonyms: 9130004K12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108853
Homologene: 5905
Lrriq1
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: LOC380658, 4930503E15Rik, Gm1557
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74978
Homologene: 46007
Rmdn2
Name: regulator of microtubule dynamics 2
Synonyms: Fam82a1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381110
VEGA: 17
Homologene: 71930
Serpina1a
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1A
Synonyms: PI1, Aat-2, Spi1-1, Aat2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20700
HGNC: HGNC:8941
Homologene: 20103
Or52e4
Name: olfactory receptor family 52 subfamily E member 4
Synonyms: GA_x6K02T2PBJ9-7685262-7686200, MOR32-11, Olfr677
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258355
Homologene: 81596
Notch4
Name: notch 4
Synonyms: Int-3, Int3, N4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18132
HGNC: HGNC:7884
Homologene: 3351
Ankdd1a
Name: ankyrin repeat and death domain containing 1A
Synonyms: LOC384945, EG330963
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330963
VEGA: 9
Homologene: 65619
Vmn2r99
Name: vomeronasal 2, receptor 99
Synonyms: EG665376
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665376
Homologene: 115024
Or5p68
Name: olfactory receptor family 5 subfamily P member 68
Synonyms: GA_x6K02T2PBJ9-10676998-10676054, MOR204-35, Olfr493
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258307
Homologene: 17188
Prr22
Name: proline rich 22
Synonyms: LOC224908, Gm546
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100504446
Homologene: 51921
Mstn
Name: myostatin
Synonyms: Gdf8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17700
HGNC: HGNC:4223
Homologene: 3850
Vmn2r67
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620672
Homologene: 115466
Hao2
Name: hydroxyacid oxidase 2
Synonyms: Hao3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56185
HGNC: HGNC:4810
Homologene: 97412
Pla2g2e
Name: phospholipase A2, group IIE
Synonyms: mGIIEsPLA2s
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26970
Homologene: 8083
Vmn1r16
Name: vomeronasal 1 receptor 16
Synonyms: V1rc29
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171202
Homologene: 123821
Coq8a
Name: coenzyme Q8A
Synonyms: 4632432J16Rik, Cabc1, Adck3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67426
Homologene: 11345
Hdhd5
Name: haloacid dehalogenase like hydrolase domain containing 5
Synonyms: A930002G03Rik, Cecr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214932
HGNC: HGNC:1843
Homologene: 32816
Or12e10
Name: olfactory receptor family 12 subfamily E member 10
Synonyms: GA_x6K02T2Q125-49311440-49312384, MOR264-19, Olfr1145
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258317
Homologene: 27123
Eef1a2
Name: eukaryotic translation elongation factor 1 alpha 2
Synonyms: Eef1a, S1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13628
HGNC: HGNC:3192
Homologene: 121568
Or5g23
Name: olfactory receptor family 5 subfamily G member 23
Synonyms: GA_x6K02T2Q125-47087719-47086775, MOR175-9, Olfr1000
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257899
Npw
Name: neuropeptide W
Synonyms: LOC381073
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381073
Homologene: 17727
Or5b95
Name: olfactory receptor family 5 subfamily B member 95
Synonyms: GA_x6K02T2RE5P-3006492-3007430, MOR202-8, Olfr1443
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258693
HGNC: HGNC:8324
Homologene: 115496
Prox2
Name: prospero homeobox 2
Synonyms: 1700058C01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73422
Homologene: 18421
Prorsd1
Name: prolyl-tRNA synthetase domain containing 1
Synonyms: 2010316F05Rik, Ncrna00117, Prdxdd1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67939
Homologene: 12215
Pramel33
Name: PRAME like 33
Synonyms: Gm16427
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100040885
Homologene: 133100
Dusp23
Name: dual specificity phosphatase 23
Synonyms: 1300005N15Rik, Ldp-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68440
Homologene: 32368
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,061,941 bp
  • T to A, chromosome 1 at 84,476,402 bp
  • T to A, chromosome 1 at 87,407,136 bp
  • T to A, chromosome 1 at 172,631,657 bp
  • T to C, chromosome 1 at 180,179,068 bp
  • G to A, chromosome 2 at 26,430,486 bp
  • T to C, chromosome 2 at 85,608,248 bp
  • G to A, chromosome 2 at 87,810,443 bp
  • C to T, chromosome 2 at 121,208,040 bp
  • G to A, chromosome 2 at 135,910,194 bp
  • C to A, chromosome 2 at 181,148,628 bp
  • T to A, chromosome 3 at 98,876,752 bp
  • T to C, chromosome 3 at 121,532,165 bp
  • C to T, chromosome 4 at 28,821,489 bp
  • A to G, chromosome 4 at 43,447,006 bp
  • G to A, chromosome 4 at 138,880,675 bp
  • A to G, chromosome 4 at 141,685,250 bp
  • T to A, chromosome 5 at 93,484,374 bp
  • T to A, chromosome 5 at 109,293,314 bp
  • G to A, chromosome 6 at 23,002,687 bp
  • G to T, chromosome 6 at 57,322,884 bp
  • A to G, chromosome 6 at 120,510,169 bp
  • G to A, chromosome 7 at 25,917,355 bp
  • T to A, chromosome 7 at 27,580,446 bp
  • T to G, chromosome 7 at 80,891,856 bp
  • T to G, chromosome 7 at 85,155,745 bp
  • T to C, chromosome 7 at 105,056,564 bp
  • T to A, chromosome 7 at 108,346,088 bp
  • C to A, chromosome 7 at 118,167,868 bp
  • A to T, chromosome 8 at 9,971,098 bp
  • C to A, chromosome 8 at 34,834,493 bp
  • A to G, chromosome 8 at 63,355,381 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 9 at 21,287,754 bp
  • T to A, chromosome 9 at 65,508,675 bp
  • T to C, chromosome 9 at 108,983,919 bp
  • T to C, chromosome 9 at 110,494,622 bp
  • G to T, chromosome 10 at 4,357,122 bp
  • T to C, chromosome 10 at 5,813,384 bp
  • T to C, chromosome 10 at 103,187,458 bp
  • A to C, chromosome 11 at 29,514,486 bp
  • A to G, chromosome 11 at 95,511,418 bp
  • A to C, chromosome 11 at 99,145,304 bp
  • G to A, chromosome 11 at 106,239,144 bp
  • A to G, chromosome 12 at 85,087,391 bp
  • T to C, chromosome 12 at 103,853,833 bp
  • T to A, chromosome 13 at 9,551,860 bp
  • C to T, chromosome 13 at 9,634,832 bp
  • T to A, chromosome 13 at 17,554,380 bp
  • ACTTCTTCT to ACTTCT, chromosome 13 at 59,649,576 bp
  • C to T, chromosome 13 at 67,708,521 bp
  • C to T, chromosome 13 at 102,804,647 bp
  • T to C, chromosome 14 at 33,410,884 bp
  • A to T, chromosome 14 at 34,593,907 bp
  • A to G, chromosome 15 at 8,252,206 bp
  • C to G, chromosome 15 at 102,241,915 bp
  • A to G, chromosome 16 at 92,397,363 bp
  • A to G, chromosome 17 at 19,378,110 bp
  • A to C, chromosome 17 at 24,658,055 bp
  • G to T, chromosome 17 at 34,584,800 bp
  • A to G, chromosome 17 at 56,771,345 bp
  • A to G, chromosome 17 at 74,562,095 bp
  • A to G, chromosome 17 at 79,621,310 bp
  • A to T, chromosome 18 at 43,353,891 bp
  • G to T, chromosome 19 at 12,680,748 bp
  • A to G, chromosome 19 at 29,719,108 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6991 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045097-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.