Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7016Btlr/Mmmh
Stock Number:
045117-MU
Citation ID:
RRID:MMRRC_045117-MU
Other Names:
R7016 (G1)
Major Collection:

Strain Information

Fgb
Name: fibrinogen beta chain
Synonyms: 2510049G14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110135
HGNC: HGNC:3662
Homologene: 3772
Sim1
Name: single-minded family bHLH transcription factor 1
Synonyms: bHLHe14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20464
VEGA: 10
Homologene: 3715
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Dnajc21
Name: DnaJ heat shock protein family (Hsp40) member C21
Synonyms: 9930116P15Rik, 4930461P20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78244
Homologene: 6752
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Tsc22d1
Name: TSC22 domain family, member 1
Synonyms: TSC-22, Egr5, Tgfb1i4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21807
Homologene: 7573
Actn1
Name: actinin, alpha 1
Synonyms: 3110023F10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109711
VEGA: 12
HGNC: HGNC:163
Homologene: 55553
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT to C, chromosome 1 at 88,266,277 bp
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp
  • C to A, chromosome 1 at 183,087,466 bp
  • T to A, chromosome 2 at 23,186,355 bp
  • T to C, chromosome 2 at 24,762,848 bp
  • T to A, chromosome 2 at 72,378,635 bp
  • A to G, chromosome 2 at 82,990,635 bp
  • A to G, chromosome 2 at 155,716,072 bp
  • T to A, chromosome 2 at 163,564,273 bp
  • T to C, chromosome 3 at 35,841,036 bp
  • A to G, chromosome 3 at 83,046,064 bp
  • T to C, chromosome 4 at 9,630,604 bp
  • T to A, chromosome 4 at 117,871,116 bp
  • T to A, chromosome 5 at 8,936,843 bp
  • A to G, chromosome 5 at 121,521,038 bp
  • T to A, chromosome 6 at 48,449,164 bp
  • G to A, chromosome 7 at 19,758,443 bp
  • A to G, chromosome 7 at 49,770,835 bp
  • A to G, chromosome 7 at 55,794,229 bp
  • A to G, chromosome 7 at 100,878,977 bp
  • A to G, chromosome 7 at 103,929,530 bp
  • A to T, chromosome 7 at 104,348,206 bp
  • A to T, chromosome 7 at 105,743,998 bp
  • A to G, chromosome 7 at 108,755,711 bp
  • A to T, chromosome 7 at 121,147,766 bp
  • A to G, chromosome 7 at 140,493,240 bp
  • A to G, chromosome 7 at 141,237,563 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • T to C, chromosome 8 at 47,847,548 bp
  • A to T, chromosome 8 at 56,544,199 bp
  • T to G, chromosome 8 at 61,515,998 bp
  • TG to TGG, chromosome 9 at 7,465,083 bp
  • A to G, chromosome 9 at 14,593,699 bp
  • G to A, chromosome 9 at 35,223,718 bp
  • A to T, chromosome 9 at 95,786,941 bp
  • G to C, chromosome 10 at 4,368,646 bp
  • C to T, chromosome 10 at 50,984,250 bp
  • T to A, chromosome 10 at 77,982,956 bp
  • T to C, chromosome 10 at 79,639,956 bp
  • A to G, chromosome 10 at 80,648,615 bp
  • C to A, chromosome 10 at 127,559,967 bp
  • T to G, chromosome 10 at 128,485,329 bp
  • A to G, chromosome 11 at 3,530,368 bp
  • T to G, chromosome 11 at 49,215,937 bp
  • A to G, chromosome 11 at 73,119,516 bp
  • A to G, chromosome 11 at 75,510,919 bp
  • A to T, chromosome 11 at 79,027,536 bp
  • A to G, chromosome 12 at 37,109,224 bp
  • T to A, chromosome 12 at 80,172,968 bp
  • T to A, chromosome 12 at 103,675,371 bp
  • T to A, chromosome 12 at 105,781,679 bp
  • A to T, chromosome 13 at 3,576,857 bp
  • A to C, chromosome 13 at 66,972,621 bp
  • A to T, chromosome 13 at 116,895,091 bp
  • T to A, chromosome 14 at 50,950,249 bp
  • C to A, chromosome 14 at 76,417,542 bp
  • T to A, chromosome 14 at 101,487,441 bp
  • T to A, chromosome 15 at 6,774,880 bp
  • G to T, chromosome 15 at 10,461,407 bp
  • T to A, chromosome 15 at 95,229,151 bp
  • A to G, chromosome 15 at 102,454,364 bp
  • C to A, chromosome 16 at 30,338,490 bp
  • G to A, chromosome 17 at 37,395,203 bp
  • A to T, chromosome 18 at 64,269,583 bp
  • G to T, chromosome 19 at 4,121,402 bp
  • A to G, chromosome 19 at 40,795,804 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7016 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045117-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.