Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7016Btlr/Mmmh
Stock Number:
045117-MU
Citation ID:
RRID:MMRRC_045117-MU
Other Names:
R7016 (G1)
Major Collection:

Strain Information

Fgb
Name: fibrinogen beta chain
Synonyms: 2510049G14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110135
HGNC: HGNC:3662
Homologene: 3772
Sim1
Name: single-minded family bHLH transcription factor 1
Synonyms: bHLHe14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20464
VEGA: 10
Homologene: 3715
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Dnajc21
Name: DnaJ heat shock protein family (Hsp40) member C21
Synonyms: 9930116P15Rik, 4930461P20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78244
Homologene: 6752
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Tsc22d1
Name: TSC22 domain family, member 1
Synonyms: TSC-22, Egr5, Tgfb1i4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21807
Homologene: 7573
Actn1
Name: actinin, alpha 1
Synonyms: 3110023F10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109711
VEGA: 12
HGNC: HGNC:163
Homologene: 55553
Amhr2
Name: anti-Mullerian hormone type 2 receptor
Synonyms: MIS TypeII receptor, MISIIR
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110542
HGNC: HGNC:465
Homologene: 10746
Map3k20
Name: mitogen-activated protein kinase kinase kinase 20
Synonyms: MLTKbeta, MLTKalpha, B230120H23Rik, Zak
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65964
Homologene: 32331
Wwc2
Name: WW, C2 and coiled-coil domain containing 2
Synonyms: D8Ertd594e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52357
Homologene: 32618
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Amotl1
Name: angiomotin-like 1
Synonyms: 4932416D09Rik, JEAP, 2310067L22Rik, 2310010G08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75723
Homologene: 43977
Aip
Name: aryl-hydrocarbon receptor-interacting protein
Synonyms: Ara9, Xap2, D19Bwg1412e, Fkbp16
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11632
HGNC: HGNC:358
Homologene: 2959
Bcam
Name: basal cell adhesion molecule
Synonyms: B-CAM, 1200005K12Rik, Lu
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57278
HGNC: HGNC:6722
Homologene: 21149
Atp13a3
Name: ATPase type 13A3
Synonyms: LOC224088, LOC224087, LOC385637
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224088
Homologene: 23455
Arhgef17
Name: Rho guanine nucleotide exchange factor 17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207212
Homologene: 129601
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101471
Homologene: 16377
Zbtb2
Name: zinc finger and BTB domain containing 2
Synonyms: LOC381990
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 381990
VEGA: 10
Homologene: 10837
Ak7
Name: adenylate kinase 7
Synonyms: 4930502N02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78801
VEGA: 12
Homologene: 14268
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Yme1l1
Name: YME1-like 1 (S. cerevisiae)
Synonyms: Ftsh, ATP-dependent metalloprotease FtsH1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27377
Homologene: 31996
Asph
Name: aspartate-beta-hydroxylase
Synonyms: cI-37, 2310005F16Rik, aspartyl beta-hydroxylase, calsequestrin-binding protein, Junctin, jumbug, BAH, 3110001L23Rik, junctate
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Palld
Name: palladin, cytoskeletal associated protein
Synonyms: 2410003B16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72333
Homologene: 75052
Fam118b
Name: family with sequence similarity 118, member B
Synonyms: 2310022O21Rik, 2700018L24Rik, C030004A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109229
Homologene: 11584
Pnp
Name: purine-nucleoside phosphorylase
Synonyms: Np-2, Np-1, Np, Pnp, Pnp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18950
HGNC: HGNC:7892
Homologene: 227
Smarcc2
Name: SWI/SNF related BAF chromatin remodeling complex subunit C2
Synonyms: 5930405J04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68094
VEGA: 10
Homologene: 2312
Itgae
Name: integrin alpha E, epithelial-associated
Synonyms: CD103, alpha-E1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16407
HGNC: HGNC:6147
Homologene: 113560
Abcb4
Name: ATP-binding cassette, sub-family B member 4
Synonyms: mdr-2, Mdr2, Pgy-2, Pgy2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18670
HGNC: HGNC:45
Homologene: 136368
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Or51m1
Name: olfactory receptor family 51 subfamily M member 1
Synonyms: GA_x6K02T2PBJ9-6662699-6663658, MOR3-1, Olfr631
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258961
Homologene: 64935
Atp11b
Name: ATPase, class VI, type 11B
Synonyms: 1110019I14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76295
Homologene: 32919
Pls1
Name: plastin 1 (I-isoform)
Synonyms: I-fimbrin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102502
HGNC: HGNC:9090
Homologene: 68270
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, alpha(1B), Cav2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Htatip2
Name: HIV-1 Tat interactive protein 2
Synonyms: TIP30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53415
Homologene: 4676
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
St8sia3
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Synonyms: ST8SiaIII, Siat8c
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20451
Homologene: 8285
Mmp1a
Name: matrix metallopeptidase 1a (interstitial collagenase)
Synonyms: Mcol-A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83995
VEGA: 9
HGNC: HGNC:7155
Homologene: 20544
Ksr1
Name: kinase suppressor of ras 1
Synonyms: D11Bhm183e, B-KSR1, D11Bhm184e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16706
HGNC: HGNC:6465
Homologene: 8410
Nell2
Name: NEL-like 2
Synonyms: mel91, A330108N19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54003
VEGA: 15
HGNC: HGNC:7751
Homologene: 4488
Trim12c
Name: tripartite motif-containing 12C
Synonyms: Trim12-2, 9230105E10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319236
Homologene: 75345
Cfap410
Name: cilia and flagella associated protein 410
Synonyms: D10Jhu13e, 1810043G02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67884
HGNC: HGNC:1260
Homologene: 3619
Rilp
Name: Rab interacting lysosomal protein
Synonyms: LOC333615
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 280408
Homologene: 19596
Tbc1d4
Name: TBC1 domain family, member 4
Synonyms: 5930406J04Rik, AS160
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210789
Homologene: 45451
Or5e1
Name: olfactory receptor family 5 subfamily E member 1
Synonyms: GA_x6K02T2PBJ9-11084889-11085818, MOR195-1, Olfr513
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258718
Homologene: 64908
Hnf4a
Name: hepatic nuclear factor 4, alpha
Synonyms: HNF-4, Nr2a1, Nuclear receptor 2A1, HNF4 alpha, Tcf14, MODY1, Tcf4, Hnf4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15378
HGNC: HGNC:5024
Homologene: 395
Cimap1d
Name: CIMAP1 family member D
Synonyms: LOC382384, Odf3l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 382384
VEGA: 10
Homologene: 16801
Btbd2
Name: BTB domain containing 2
Synonyms: 2610037C03Rik, 4930512K17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 208198
Homologene: 32365
Ptdss1
Name: phosphatidylserine synthase 1
Synonyms: PtdSer Synthase-1, PSS-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19210
VEGA: 13
HGNC: HGNC:9587
Homologene: 7494
Cep44
Name: centrosomal protein 44
Synonyms: 4933440G23Rik, BC088983
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382010
Homologene: 12738
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: 2810430O08Rik, D13Ertd275e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 52552
VEGA: 13
Homologene: 11621
Zfp62
Name: zinc finger protein 62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22720
Homologene: 40686
Edem2
Name: ER degradation enhancer, mannosidase alpha-like 2
Synonyms: 9530090G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108687
Homologene: 10075
Disp1
Name: dispatched RND transporter family member 1
Synonyms: DispA, 1190008H24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Taf10
Name: TATA-box binding protein associated factor 10
Synonyms: TAFII30, Taf2h, 30kDa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 24075
Homologene: 86923
Meox2
Name: mesenchyme homeobox 2
Synonyms: Gax, Mox-2, Mox2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17286
HGNC: HGNC:7014
Homologene: 4330
Adam1a
Name: a disintegrin and metallopeptidase domain 1a
Synonyms: Ftna, PH-30 alpha, fertilin alpha
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 280668
HGNC: HGNC:187
Homologene: 73803
Ccdc24
Name: coiled-coil domain containing 24
Synonyms: LOC381546
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381546
Or13a22
Name: olfactory receptor family 13 subfamily A member 22
Synonyms: GA_x6K02T2PBJ9-42641642-42642574, MOR253-7, Olfr535
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258956
Homologene: 138320
Serpina16
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 16
Synonyms: LOC194604, Gm46
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 194604
Homologene: 52303
Or12d16-ps1
Name: olfactory receptor family 12 subfamily D member 16, pseudogene 1
Synonyms: MOR250-6, GA_x6K02T2PSCP-1855511-1856437, Olfr106, Olfr106-ps
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257925
Cc2d2b
Name: coiled-coil and C2 domain containing 2B
Synonyms: EG668310
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668310
Homologene: 141114
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT to C, chromosome 1 at 88,266,277 bp
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp
  • C to A, chromosome 1 at 183,087,466 bp
  • T to A, chromosome 2 at 23,186,355 bp
  • T to C, chromosome 2 at 24,762,848 bp
  • T to A, chromosome 2 at 72,378,635 bp
  • A to G, chromosome 2 at 82,990,635 bp
  • A to G, chromosome 2 at 155,716,072 bp
  • T to A, chromosome 2 at 163,564,273 bp
  • T to C, chromosome 3 at 35,841,036 bp
  • A to G, chromosome 3 at 83,046,064 bp
  • T to C, chromosome 4 at 9,630,604 bp
  • T to A, chromosome 4 at 117,871,116 bp
  • T to A, chromosome 5 at 8,936,843 bp
  • A to G, chromosome 5 at 121,521,038 bp
  • T to A, chromosome 6 at 48,449,164 bp
  • G to A, chromosome 7 at 19,758,443 bp
  • A to G, chromosome 7 at 49,770,835 bp
  • A to G, chromosome 7 at 55,794,229 bp
  • A to G, chromosome 7 at 100,878,977 bp
  • A to G, chromosome 7 at 103,929,530 bp
  • A to T, chromosome 7 at 104,348,206 bp
  • A to T, chromosome 7 at 105,743,998 bp
  • A to G, chromosome 7 at 108,755,711 bp
  • A to T, chromosome 7 at 121,147,766 bp
  • A to G, chromosome 7 at 140,493,240 bp
  • A to G, chromosome 7 at 141,237,563 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • T to C, chromosome 8 at 47,847,548 bp
  • A to T, chromosome 8 at 56,544,199 bp
  • T to G, chromosome 8 at 61,515,998 bp
  • TG to TGG, chromosome 9 at 7,465,083 bp
  • A to G, chromosome 9 at 14,593,699 bp
  • G to A, chromosome 9 at 35,223,718 bp
  • A to T, chromosome 9 at 95,786,941 bp
  • G to C, chromosome 10 at 4,368,646 bp
  • C to T, chromosome 10 at 50,984,250 bp
  • T to A, chromosome 10 at 77,982,956 bp
  • T to C, chromosome 10 at 79,639,956 bp
  • A to G, chromosome 10 at 80,648,615 bp
  • C to A, chromosome 10 at 127,559,967 bp
  • T to G, chromosome 10 at 128,485,329 bp
  • A to G, chromosome 11 at 3,530,368 bp
  • T to G, chromosome 11 at 49,215,937 bp
  • A to G, chromosome 11 at 73,119,516 bp
  • A to G, chromosome 11 at 75,510,919 bp
  • A to T, chromosome 11 at 79,027,536 bp
  • A to G, chromosome 12 at 37,109,224 bp
  • T to A, chromosome 12 at 80,172,968 bp
  • T to A, chromosome 12 at 103,675,371 bp
  • T to A, chromosome 12 at 105,781,679 bp
  • A to T, chromosome 13 at 3,576,857 bp
  • A to C, chromosome 13 at 66,972,621 bp
  • A to T, chromosome 13 at 116,895,091 bp
  • T to A, chromosome 14 at 50,950,249 bp
  • C to A, chromosome 14 at 76,417,542 bp
  • T to A, chromosome 14 at 101,487,441 bp
  • T to A, chromosome 15 at 6,774,880 bp
  • G to T, chromosome 15 at 10,461,407 bp
  • T to A, chromosome 15 at 95,229,151 bp
  • A to G, chromosome 15 at 102,454,364 bp
  • C to A, chromosome 16 at 30,338,490 bp
  • G to A, chromosome 17 at 37,395,203 bp
  • A to T, chromosome 18 at 64,269,583 bp
  • G to T, chromosome 19 at 4,121,402 bp
  • A to G, chromosome 19 at 40,795,804 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7016 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045117-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.