Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7070Btlr/Mmmh
Stock Number:
045166-MU
Citation ID:
RRID:MMRRC_045166-MU
Other Names:
R7070 (G1)
Major Collection:

Strain Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Chrnb3
Name: cholinergic receptor, nicotinic, beta polypeptide 3
Synonyms: Acrb3, 5730417K16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108043
HGNC: HGNC:1963
Homologene: 36035
Nrg1
Name: neuregulin 1
Synonyms: HGL, HRG, Hgl, SMDF, GGF, ARIA, heregulin, D230005F13Rik, HRGalpha, 6030402G23Rik, GGFII, NDF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Snta1
Name: syntrophin, acidic 1
Synonyms: alpha1-syntrophin, Snt1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20648
Homologene: 2331
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Gtf2i
Name: general transcription factor II I
Synonyms: TFII-I, BAP-135, 6030441I21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17776
Homologene: 7428
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 34,275,302 bp
  • C to T, chromosome 1 at 75,527,615 bp
  • T to A, chromosome 1 at 88,201,502 bp
  • A to C, chromosome 1 at 168,195,768 bp
  • T to A, chromosome 1 at 172,377,666 bp
  • T to G, chromosome 2 at 25,442,995 bp
  • A to G, chromosome 2 at 57,998,609 bp
  • C to T, chromosome 2 at 71,088,513 bp
  • G to A, chromosome 2 at 85,887,690 bp
  • T to A, chromosome 2 at 112,249,461 bp
  • T to C, chromosome 2 at 154,381,059 bp
  • G to T, chromosome 3 at 40,976,651 bp
  • T to A, chromosome 3 at 98,742,471 bp
  • A to G, chromosome 3 at 103,928,983 bp
  • A to T, chromosome 3 at 146,512,184 bp
  • T to C, chromosome 4 at 19,425,593 bp
  • A to T, chromosome 4 at 116,310,855 bp
  • T to C, chromosome 4 at 133,861,448 bp
  • C to T, chromosome 4 at 135,416,587 bp
  • G to T, chromosome 5 at 77,047,277 bp
  • T to A, chromosome 5 at 134,282,803 bp
  • ACATCAGGATCC to ACATCAGGATCCCCATCAGGATCC, chromosome 6 at 4,756,454 bp
  • A to G, chromosome 6 at 49,339,862 bp
  • T to C, chromosome 6 at 65,953,248 bp
  • T to C, chromosome 6 at 126,874,024 bp
  • C to T, chromosome 6 at 140,041,920 bp
  • T to C, chromosome 7 at 4,133,364 bp
  • G to A, chromosome 7 at 64,400,330 bp
  • T to C, chromosome 7 at 85,411,480 bp
  • A to G, chromosome 7 at 100,629,857 bp
  • T to C, chromosome 7 at 105,734,876 bp
  • A to G, chromosome 7 at 139,921,828 bp
  • A to T, chromosome 8 at 27,393,961 bp
  • T to A, chromosome 8 at 31,849,437 bp
  • A to G, chromosome 8 at 71,684,611 bp
  • G to A, chromosome 8 at 117,596,306 bp
  • G to A, chromosome 9 at 18,645,923 bp
  • T to A, chromosome 10 at 44,286,154 bp
  • A to T, chromosome 10 at 78,917,268 bp
  • G to A, chromosome 10 at 121,641,974 bp
  • T to A, chromosome 11 at 9,290,701 bp
  • A to G, chromosome 11 at 58,117,452 bp
  • T to G, chromosome 11 at 83,276,705 bp
  • C to A, chromosome 11 at 116,654,025 bp
  • A to G, chromosome 12 at 83,969,858 bp
  • A to G, chromosome 12 at 113,625,809 bp
  • C to A, chromosome 13 at 13,757,444 bp
  • T to A, chromosome 14 at 13,493,628 bp
  • C to T, chromosome 14 at 53,704,455 bp
  • A to G, chromosome 14 at 60,779,783 bp
  • T to A, chromosome 15 at 21,583,829 bp
  • T to A, chromosome 15 at 54,899,289 bp
  • T to A, chromosome 15 at 64,920,555 bp
  • C to T, chromosome 15 at 92,254,036 bp
  • T to C, chromosome 15 at 98,082,306 bp
  • A to G, chromosome 15 at 102,104,533 bp
  • T to C, chromosome 16 at 9,579,424 bp
  • A to G, chromosome 16 at 29,334,061 bp
  • CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG to CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG, chromosome 16 at 91,656,841 bp
  • C to G, chromosome 16 at 95,295,831 bp
  • T to A, chromosome 17 at 17,704,051 bp
  • G to A, chromosome 17 at 25,122,997 bp
  • A to G, chromosome 17 at 26,934,333 bp
  • C to A, chromosome 17 at 36,989,159 bp
  • T to G, chromosome 18 at 35,621,781 bp
  • C to T, chromosome 18 at 36,791,112 bp
  • A to G, chromosome 18 at 38,301,728 bp
  • A to T, chromosome 18 at 43,557,328 bp
  • A to T, chromosome 19 at 4,918,328 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7070 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045166-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.