Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7094Btlr/Mmmh
Stock Number:
045187-MU
Citation ID:
RRID:MMRRC_045187-MU
Other Names:
R7094 (G1)
Major Collection:

Strain Information

Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Cyp11b2
Name: cytochrome P450, family 11, subfamily b, polypeptide 2
Synonyms: aldosterone synthase, Cyp11b-2, Cyp11b, steroid-11-beta-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13072
Homologene: 128035
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Bub1
Name: BUB1, mitotic checkpoint serine/threonine kinase
Synonyms: Bub1a, D2Xrf87
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12235
HGNC: HGNC:1148
Homologene: 37910
Lars2
Name: leucyl-tRNA synthetase, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102436
VEGA: 9
Homologene: 6526
Taf2
Name: TATA-box binding protein associated factor 2
Synonyms: TAFII150, CIF150, TAF2B, 4732460C16Rik, 150kDa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319944
VEGA: 15
Homologene: 31137
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Slc39a2
Name: solute carrier family 39 (zinc transporter), member 2
Synonyms: zip2, F730005G13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 214922
Homologene: 40957
Slitrk5
Name: SLIT and NTRK-like family, member 5
Synonyms: 2610019D03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75409
VEGA: 14
Homologene: 9193
Sez6l2
Name: seizure related 6 homolog like 2
Synonyms: Psk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233878
Homologene: 8237
Mcm9
Name: minichromosome maintenance 9 homologous recombination repair factor
Synonyms: 9030408O17Rik, Mcmdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71567
VEGA: 10
Homologene: 13546
Map2
Name: microtubule-associated protein 2
Synonyms: MAP-2, G1-397-34, Mtap2, repro4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Actl6a
Name: actin-like 6A
Synonyms: Actl6, Baf53a, 2810432C06Rik, ARP4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56456
Homologene: 55811
Ccdc85c
Name: coiled-coil domain containing 85C
Synonyms: Gm9010, hhy
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668158
VEGA: 12
Homologene: 82238
Pcdh17
Name: protocadherin 17
Synonyms: LOC219228, C030033F14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219228
VEGA: 14
Homologene: 8700
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, MINK, Ysk2, Map4k6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238455
Homologene: 18813
Ttc22
Name: tetratricopeptide repeat domain 22
Synonyms: 4732467L16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230576
Homologene: 89253
Actn2
Name: actinin alpha 2
Synonyms: 1110008F24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11472
HGNC: HGNC:164
Homologene: 31016
Tgm7
Name: transglutaminase 7
Synonyms: TGz
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 640543
Homologene: 14192
Cebpe
Name: CCAAT/enhancer binding protein epsilon
Synonyms: C/EBPe, C/EBPepsilon, CRP1, LOC239097
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110794
VEGA: 14
HGNC: HGNC:1836
Homologene: 1367
Cd209g
Name: CD209g antigen
Synonyms: 2310066I10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70192
Homologene: 137382
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, D10Bwg1379e, BIG3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Gnptab
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432486
Homologene: 32576
Or4a71
Name: olfactory receptor family 4 subfamily A member 71
Synonyms: GA_x6K02T2Q125-50972538-50971621, MOR231-4, Olfr1243
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258971
Homologene: 27317
Atf6b
Name: activating transcription factor 6 beta
Synonyms: Creb-rp, ATF6beta, Crebl1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12915
HGNC: HGNC:2349
Homologene: 31238
Ergic3
Name: ERGIC and golgi 3
Synonyms: CGI-54, NY-BR-84, 2310015B14Rik, D2Ucla1, Sdbcag84
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66366
Homologene: 5289
Zfp820
Name: zinc finger protein 820
Synonyms: 2610036F08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75424
VEGA: 17
Vstm2a
Name: V-set and transmembrane domain containing 2A
Synonyms: 9330184N17Rik, Vstm2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 211739
Homologene: 17123
Has2
Name: hyaluronan synthase 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15117
HGNC: HGNC:4819
Homologene: 3892
Vmn2r99
Name: vomeronasal 2, receptor 99
Synonyms: EG665376
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665376
Homologene: 115024
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, restin, Clip 170
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Tgm1
Name: transglutaminase 1, K polypeptide
Synonyms: protein-glutamine-gamma-glutamyltransferase, K polypeptide, TG K, TGase 1, 2310004J08Rik, TGase1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21816
VEGA: 14
Homologene: 306
Trim15
Name: tripartite motif-containing 15
Synonyms: 1810012B10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69097
Homologene: 23819
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glur-6, Glur6, Glurbeta2, C130030K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Kics2
Name: KICSTOR subunit 2
Synonyms: BC048403
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270802
Homologene: 17580
Or5p60
Name: olfactory receptor family 5 subfamily P member 60
Synonyms: GA_x6K02T2PBJ9-10454128-10453163, MOR204-16, Olfr484
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258492
Homologene: 36987
Cfap100
Name: cilia and flagella associated protein 100
Synonyms: C030041G11Rik, C230069K22Rik, Ccdc37
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243538
Homologene: 18456
Chil6
Name: chitinase-like 6
Synonyms: BYm, BC051070
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229688
Homologene: 77638
Upb1
Name: ureidopropionase, beta
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103149
Homologene: 9471
Tas2r106
Name: taste receptor, type 2, member 106
Synonyms: T2R06, Tas2r6, mGR06, mt2r44
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387341
Homologene: 130071
Nrsn1
Name: neurensin 1
Synonyms: Vmp, Neuro-p24, Neurensin-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22360
Homologene: 7597
Eva1a
Name: eva-1 homolog A, regulator of programmed cell death
Synonyms: Tmem166, Fam176a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232146
Homologene: 12969
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Lipo5
Name: lipase, member O5
Synonyms: Gm8975
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668095
Or1ab2
Name: olfactory receptor family 1 subfamily AB member 2
Synonyms: GA_x6K02T2NUPS-241490-242431, MOR130-1, Olfr374
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 258335
Homologene: 131127
Slc35e4
Name: solute carrier family 35, member E4
Synonyms: A330108F03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103710
Homologene: 37409
Or8k36
Name: olfactory receptor family 8 subfamily K member 36
Synonyms: GA_x6K02T2Q125-48092599-48091658, MOR191-3, Or8k36-ps1, Olfr1083-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404326
Grem2
Name: gremlin 2, DAN family BMP antagonist
Synonyms: Prdc
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23893
Homologene: 8023
Gm5565
Name: predicted gene 5565
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433961
Homologene: 86127
Or51f23b
Name: olfactory receptor family 51 subfamily F member 23B
Synonyms: GA_x6K02T2PBJ9-5470572-5469628, MOR14-1, Olfr560
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259117
Homologene: 51824
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 43,968,988 bp
  • G to T, chromosome 1 at 66,412,727 bp
  • T to C, chromosome 1 at 174,836,989 bp
  • C to A, chromosome 2 at 77,041,453 bp
  • T to C, chromosome 2 at 86,607,328 bp
  • A to T, chromosome 2 at 89,527,558 bp
  • C to T, chromosome 2 at 121,099,008 bp
  • T to A, chromosome 2 at 127,821,761 bp
  • G to A, chromosome 2 at 156,016,763 bp
  • A to T, chromosome 2 at 177,317,345 bp
  • A to T, chromosome 3 at 32,706,338 bp
  • G to A, chromosome 3 at 38,889,874 bp
  • T to C, chromosome 3 at 106,404,170 bp
  • G to A, chromosome 4 at 106,635,907 bp
  • C to T, chromosome 5 at 76,859,032 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • T to C, chromosome 5 at 123,623,270 bp
  • T to C, chromosome 5 at 146,158,274 bp
  • C to T, chromosome 6 at 82,092,043 bp
  • T to C, chromosome 6 at 84,100,202 bp
  • T to C, chromosome 6 at 90,413,454 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • T to C, chromosome 6 at 131,678,579 bp
  • A to G, chromosome 7 at 102,753,098 bp
  • G to T, chromosome 7 at 108,124,633 bp
  • A to G, chromosome 7 at 126,952,924 bp
  • T to C, chromosome 8 at 4,136,790 bp
  • A to T, chromosome 8 at 72,109,503 bp
  • A to G, chromosome 8 at 90,989,561 bp
  • T to C, chromosome 9 at 123,459,585 bp
  • G to T, chromosome 10 at 18,646,439 bp
  • A to T, chromosome 10 at 49,355,916 bp
  • T to C, chromosome 10 at 53,620,157 bp
  • C to A, chromosome 10 at 75,438,208 bp
  • T to G, chromosome 10 at 88,379,504 bp
  • A to G, chromosome 10 at 121,740,193 bp
  • T to C, chromosome 11 at 3,913,118 bp
  • A to T, chromosome 11 at 9,298,610 bp
  • G to A, chromosome 11 at 16,257,990 bp
  • C to A, chromosome 11 at 70,610,075 bp
  • T to A, chromosome 11 at 119,437,604 bp
  • GCCGCCGCCGCCAGCGCCCCCCGCCGCCGCCAGCGCC to GCCGCCGCCGCCAGCGCC, chromosome 12 at 108,274,618 bp
  • T to A, chromosome 12 at 119,450,391 bp
  • A to G, chromosome 13 at 12,309,657 bp
  • A to T, chromosome 13 at 25,253,741 bp
  • T to C, chromosome 13 at 68,579,684 bp
  • G to T, chromosome 14 at 51,893,689 bp
  • C to T, chromosome 14 at 54,710,603 bp
  • T to C, chromosome 14 at 55,704,843 bp
  • A to G, chromosome 14 at 84,447,395 bp
  • C to T, chromosome 14 at 111,680,836 bp
  • A to T, chromosome 15 at 27,891,448 bp
  • A to G, chromosome 15 at 28,453,336 bp
  • A to G, chromosome 15 at 55,060,086 bp
  • T to A, chromosome 15 at 56,681,621 bp
  • A to G, chromosome 15 at 74,853,658 bp
  • T to A, chromosome 17 at 19,379,311 bp
  • T to C, chromosome 17 at 21,819,265 bp
  • G to A, chromosome 17 at 34,653,816 bp
  • T to C, chromosome 17 at 36,862,896 bp
  • T to A, chromosome 19 at 33,468,849 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7094 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045187-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.