Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7129Btlr/Mmmh
Stock Number:
045214-MU
Citation ID:
RRID:MMRRC_045214-MU
Other Names:
R7129 (G1)
Major Collection:

Strain Information

Zbtb8a
Name: zinc finger and BTB domain containing 8a
Synonyms: 2410081M15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73680
Homologene: 12506
Kif20a
Name: kinesin family member 20A
Synonyms: Rabkinesin-6, Rab6kifl
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19348
VEGA: 18
HGNC: HGNC:9787
Homologene: 38093
Etaa1
Name: Ewing tumor-associated antigen 1
Synonyms: 5730466H23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68145
Homologene: 10369
Exoc4
Name: exocyst complex component 4
Synonyms: Sec8, Sec8l1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20336
Homologene: 40654
Bms1
Name: BMS1, ribosome biogenesis factor
Synonyms: Bms1l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213895
Homologene: 7065
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 2810004D21Rik, 4632404O06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Usp22
Name: ubiquitin specific peptidase 22
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216825
Homologene: 52664
Stip1
Name: stress-induced phosphoprotein 1
Synonyms: p60, IEF SSP 3521, Hop, Hsp70/Hsp90 organizing protein, STI1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20867
VEGA: 19
Homologene: 4965
Usp24
Name: ubiquitin specific peptidase 24
Synonyms: 2810030C21Rik, 2700066K03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329908
Homologene: 35420
Elp1
Name: elongator complex protein 1
Synonyms: 3110040G09Rik, C78473, IKAP, Ikbkap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Chlsn
Name: cholesin
Synonyms: 3110082I17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73212
Homologene: 49901
Nufip1
Name: nuclear FMR1 interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27275
VEGA: 14
HGNC: HGNC:8057
Homologene: 8216
Zbtb21
Name: zinc finger and BTB domain containing 21
Synonyms: Znf295, 5430437K12Rik, B430213I24Rik, Zfp295
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114565
VEGA: 16
Homologene: 10799
Podxl2
Name: podocalyxin-like 2
Synonyms: PODLX2, D130074J02Rik, Endoglycan
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319655
Homologene: 9254
Ifitm7
Name: interferon induced transmembrane protein 7
Synonyms: 4933438K12Rik, Mil4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74482
HGNC: HGNC:5414
Hapln3
Name: hyaluronan and proteoglycan link protein 3
Synonyms: Lpr3, 4930554N11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67666
Homologene: 18654
Oit3
Name: oncoprotein induced transcript 3
Synonyms: EF-9
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18302
Homologene: 7870
Rab4a
Name: RAB4A, member RAS oncogene family
Synonyms: Rab4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19341
HGNC: HGNC:9781
Homologene: 101538
Elf2
Name: E74-like factor 2
Synonyms: NERF-2, 2610036A20Rik, A230104O07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69257
HGNC: HGNC:3317
Homologene: 5006
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Dhx33
Name: DEAH-box helicase 33
Synonyms: 9430096J02Rik, 3110057P17Rik, Ddx33, DEAH (Asp-Glu-Ala-His) box polypeptide 33
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216877
Homologene: 56235
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Dok7
Name: docking protein 7
Synonyms: EF-12, A930013K19Rik, Dok-7, Oit5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231134
Homologene: 18210
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Iqch
Name: IQ motif containing H
Synonyms: 4921504K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78250
Homologene: 11258
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Abcg4
Name: ATP binding cassette subfamily G member 4
Synonyms: 6430517O04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 192663
Homologene: 75179
Tmem63a
Name: transmembrane protein 63a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208795
Homologene: 101673
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Il6ra
Name: interleukin 6 receptor, alpha
Synonyms: IL-6 receptor alpha chain, CD126, Il6r, IL-6R
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16194
HGNC: HGNC:6019
Homologene: 474
Or5b98
Name: olfactory receptor family 5 subfamily B member 98
Synonyms: GA_x6K02T2RE5P-3283121-3284098, MOR202-33, Olfr1450
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258368
Mcrs1
Name: microspherule protein 1
Synonyms: P78, ICP22BP, MSP58, C78274
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 51812
VEGA: 15
HGNC: HGNC:6960
Homologene: 4622
Or2ag17
Name: olfactory receptor family 2 subfamily AG member 17
Synonyms: GA_x6K02T2PBJ9-9168355-9167405, MOR283-10P, Olfr699
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258180
Homologene: 79391
Akt1
Name: thymoma viral proto-oncogene 1
Synonyms: PKB/Akt, PKBalpha, Akt, PKB
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11651
HGNC: HGNC:391
Homologene: 3785
Plin5
Name: perilipin 5
Synonyms: MLDP, Lsdp5, 2310076L09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66968
Homologene: 41654
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Tas2r117
Name: taste receptor, type 2, member 117
Synonyms: Tas2r17, mGR17, T2R17, mt2r54
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353166
Homologene: 130073
Adamts17
Name: ADAM metallopeptidase with thrombospondin type 1 motif 17
Synonyms: AU023434
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233332
Homologene: 16373
Bfsp2
Name: beaded filament structural protein 2, phakinin
Synonyms: CP49
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107993
HGNC: HGNC:1041
Homologene: 20791
Vmn1r23
Name: vomeronasal 1 receptor 23
Synonyms: V1rc24
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171197
Homologene: 110825
Adh1
Name: alcohol dehydrogenase 1 (class I)
Synonyms: ADH-AA, class I alcohol dehydrogenase, Adh-1-t, Adh-1t, Adh-1, Adh1-t, Adh1-e, Adh1tl, Adh-1e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11522
Homologene: 73888
1700030K09Rik
Name: RIKEN cDNA 1700030K09 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72254
Homologene: 12975
BC051019
Name: cDNA sequence BC051019
Synonyms: D7H11orf16, ICRFP703N2430Q5.5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57355
HGNC: HGNC:1169
Homologene: 49631
Cd38
Name: CD38 antigen
Synonyms: Cd38-rs1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12494
HGNC: HGNC:1667
Homologene: 1345
Vmn1r9
Name: vomeronasal 1 receptor 9
Synonyms: V1rc30
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171203
Homologene: 76459
Nkx3-2
Name: NK3 homeobox 2
Synonyms: Nkx-3.2, Bapx1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12020
HGNC: HGNC:951
Homologene: 68168
Speer4f2
Name: spermatogenesis associated glutamate (E)-rich protein 4f2
Synonyms: Gm3535, Gm3495
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100041749
Arfrp1
Name: ARF related protein 1
Synonyms: 1500006I01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76688
HGNC: HGNC:662
Homologene: 2425
Cldn16
Name: claudin 16
Synonyms: PCLN1, claudin-16, paracellin-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114141
HGNC: HGNC:2037
Homologene: 4799
Zfp51
Name: zinc finger protein 51
Synonyms: zfec12, Zfp-51
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22709
VEGA: 17
Homologene: 134003
Nmi
Name: N-myc (and STAT) interactor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64685
HGNC: HGNC:7854
Homologene: 3441
Arl11
Name: ADP-ribosylation factor-like 11
Synonyms: ARLTS1, C730007L20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219144
VEGA: 14
Homologene: 16319
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Pcdha11
Name: protocadherin alpha 11
Synonyms: Cnr7, Crnr7, A830022B16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12942
HGNC: HGNC:8665
Homologene: 75095
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 150,577,210 bp
  • T to C, chromosome 1 at 180,954,876 bp
  • A to T, chromosome 2 at 51,955,924 bp
  • A to G, chromosome 2 at 66,700,193 bp
  • C to A, chromosome 2 at 76,816,171 bp
  • G to A, chromosome 2 at 181,359,551 bp
  • T to C, chromosome 3 at 51,261,011 bp
  • T to C, chromosome 3 at 89,871,247 bp
  • T to C, chromosome 3 at 138,280,474 bp
  • T to C, chromosome 4 at 56,787,944 bp
  • T to G, chromosome 4 at 100,918,066 bp
  • T to C, chromosome 4 at 106,362,215 bp
  • G to C, chromosome 4 at 129,360,395 bp
  • A to G, chromosome 5 at 17,377,448 bp
  • T to C, chromosome 5 at 35,079,048 bp
  • A to G, chromosome 5 at 41,761,674 bp
  • A to G, chromosome 5 at 43,910,309 bp
  • A to G, chromosome 5 at 96,781,284 bp
  • A to G, chromosome 5 at 139,363,983 bp
  • T to C, chromosome 6 at 33,971,999 bp
  • A to C, chromosome 6 at 57,071,626 bp
  • A to G, chromosome 6 at 57,926,076 bp
  • A to G, chromosome 6 at 88,843,505 bp
  • G to T, chromosome 6 at 118,403,161 bp
  • A to T, chromosome 6 at 132,803,387 bp
  • T to C, chromosome 7 at 67,121,010 bp
  • C to T, chromosome 7 at 79,121,824 bp
  • T to C, chromosome 7 at 106,790,483 bp
  • T to C, chromosome 7 at 109,720,618 bp
  • A to G, chromosome 8 at 72,455,355 bp
  • A to T, chromosome 8 at 123,827,330 bp
  • T to C, chromosome 9 at 42,347,991 bp
  • T to C, chromosome 9 at 44,279,384 bp
  • C to T, chromosome 9 at 63,421,909 bp
  • C to T, chromosome 9 at 82,877,300 bp
  • T to A, chromosome 9 at 103,479,919 bp
  • T to A, chromosome 10 at 59,428,344 bp
  • T to C, chromosome 10 at 93,016,571 bp
  • GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT, chromosome 10 at 116,283,677 bp
  • T to C, chromosome 11 at 17,940,339 bp
  • T to C, chromosome 11 at 61,162,949 bp
  • A to T, chromosome 11 at 70,993,863 bp
  • A to T, chromosome 11 at 82,961,150 bp
  • A to G, chromosome 12 at 40,828,879 bp
  • A to G, chromosome 12 at 71,216,230 bp
  • A to T, chromosome 12 at 112,659,649 bp
  • A to G, chromosome 14 at 61,310,897 bp
  • A to G, chromosome 14 at 76,134,885 bp
  • G to A, chromosome 15 at 99,248,728 bp
  • A to T, chromosome 16 at 13,983,736 bp
  • A to T, chromosome 16 at 26,482,638 bp
  • AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC to AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC, chromosome 16 at 97,951,687 bp
  • T to C, chromosome 17 at 21,461,709 bp
  • T to C, chromosome 17 at 56,115,174 bp
  • A to G, chromosome 18 at 34,632,535 bp
  • A to G, chromosome 18 at 37,007,238 bp
  • A to T, chromosome 18 at 59,410,298 bp
  • C to T, chromosome 19 at 7,021,810 bp
  • A to T, chromosome 19 at 12,954,114 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7129 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045214-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.