Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7130Btlr/Mmmh
Stock Number:
045215-MU
Citation ID:
RRID:MMRRC_045215-MU
Other Names:
R7130 (G1)
Major Collection:

Strain Information

Npc2
Name: NPC intracellular cholesterol transporter 2
Synonyms: HE1, 2700012J19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67963
VEGA: 12
Homologene: 4697
Ppm1a
Name: protein phosphatase 1A, magnesium dependent, alpha isoform
Synonyms: Mpp alpha, MMPa-2, MPPa-1, 2900017D14Rik, 2310003C21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19042
VEGA: 12
HGNC: HGNC:9275
Homologene: 56428
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: D730040M03Rik, 1110025P14Rik, Srd5a2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271639
Homologene: 10188
Cdk19
Name: cyclin dependent kinase 19
Synonyms: 2700084L06Rik, Cdc2l6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78334
VEGA: 10
Homologene: 22862
Sdf2
Name: stromal cell derived factor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20316
Homologene: 5045
Abtb3
Name: ankyrin repeat and BTB domain containing 3
Synonyms: 6330404E16Rik, Btbd11
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74007
Homologene: 72536
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 37,783,884 bp
  • A to G, chromosome 1 at 38,041,776 bp
  • A to T, chromosome 1 at 45,921,224 bp
  • C to T, chromosome 1 at 92,588,912 bp
  • T to G, chromosome 1 at 134,408,021 bp
  • T to A, chromosome 1 at 165,504,047 bp
  • C to A, chromosome 1 at 176,874,601 bp
  • C to T, chromosome 1 at 181,745,958 bp
  • T to C, chromosome 2 at 76,890,669 bp
  • T to C, chromosome 2 at 90,281,922 bp
  • A to T, chromosome 2 at 129,039,181 bp
  • T to A, chromosome 2 at 154,311,672 bp
  • T to A, chromosome 3 at 38,980,787 bp
  • T to C, chromosome 3 at 94,198,527 bp
  • A to G, chromosome 3 at 94,447,290 bp
  • T to C, chromosome 4 at 46,029,693 bp
  • G to A, chromosome 4 at 109,083,099 bp
  • T to C, chromosome 4 at 151,988,916 bp
  • C to T, chromosome 5 at 14,679,342 bp
  • T to C, chromosome 5 at 65,892,864 bp
  • T to C, chromosome 5 at 76,149,837 bp
  • G to T, chromosome 6 at 8,427,185 bp
  • T to A, chromosome 6 at 72,305,824 bp
  • T to A, chromosome 7 at 45,909,477 bp
  • T to C, chromosome 7 at 87,002,266 bp
  • G to A, chromosome 7 at 105,565,331 bp
  • A to G, chromosome 7 at 106,790,182 bp
  • G to A, chromosome 7 at 127,974,413 bp
  • T to A, chromosome 8 at 45,275,538 bp
  • A to G, chromosome 8 at 106,807,101 bp
  • G to A, chromosome 8 at 125,753,584 bp
  • C to A, chromosome 8 at 127,415,683 bp
  • C to A, chromosome 9 at 18,409,847 bp
  • T to C, chromosome 9 at 44,262,341 bp
  • T to C, chromosome 9 at 48,339,537 bp
  • T to A, chromosome 9 at 51,849,747 bp
  • T to C, chromosome 9 at 58,198,292 bp
  • T to G, chromosome 9 at 96,519,404 bp
  • T to A, chromosome 9 at 99,318,170 bp
  • T to A, chromosome 9 at 109,271,282 bp
  • A to G, chromosome 10 at 40,479,765 bp
  • A to T, chromosome 10 at 51,678,380 bp
  • A to G, chromosome 10 at 75,512,117 bp
  • A to C, chromosome 10 at 85,387,555 bp
  • T to C, chromosome 11 at 78,245,997 bp
  • T to C, chromosome 12 at 17,175,809 bp
  • T to A, chromosome 12 at 72,784,233 bp
  • A to G, chromosome 12 at 84,765,307 bp
  • T to C, chromosome 13 at 3,548,891 bp
  • T to G, chromosome 13 at 21,133,246 bp
  • T to C, chromosome 13 at 37,899,748 bp
  • C to T, chromosome 13 at 77,269,902 bp
  • TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC to TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC, chromosome 15 at 27,742,313 bp
  • G to T, chromosome 15 at 96,691,382 bp
  • A to G, chromosome 15 at 98,597,229 bp
  • T to A, chromosome 16 at 50,210,442 bp
  • T to C, chromosome 17 at 7,370,425 bp
  • T to A, chromosome 17 at 33,136,288 bp
  • A to G, chromosome 18 at 37,423,506 bp
  • G to A, chromosome 18 at 37,485,445 bp
  • C to T, chromosome 18 at 61,132,378 bp
  • A to G, chromosome 19 at 6,105,988 bp
  • C to T, chromosome 19 at 7,021,810 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7130 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045215-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.