Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7095Btlr/Mmmh
Stock Number:
045243-MU
Citation ID:
RRID:MMRRC_045243-MU
Other Names:
R7095 (G1)
Major Collection:

Strain Information

Sufu
Name: SUFU negative regulator of hedgehog signaling
Synonyms: Su(Fu), 2810026F04Rik, b2b273Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24069
Homologene: 9262
Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, OB-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Secisbp2
Name: SECIS binding protein 2
Synonyms: 2210413N07Rik, SBP2, 2810012K13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75420
Homologene: 11415
Xpnpep1
Name: X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms: D230045I08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170750
Homologene: 6424
Zfp930
Name: zinc finger protein 930
Synonyms: zinc finger protein, D10627
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234358
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 82,290,098 bp
  • A to G, chromosome 1 at 184,795,240 bp
  • A to T, chromosome 1 at 189,659,176 bp
  • C to A, chromosome 2 at 28,549,308 bp
  • C to T, chromosome 2 at 52,177,623 bp
  • C to T, chromosome 2 at 86,298,677 bp
  • T to C, chromosome 3 at 29,980,954 bp
  • G to T, chromosome 3 at 70,018,694 bp
  • C to T, chromosome 3 at 86,793,259 bp
  • T to C, chromosome 3 at 93,827,061 bp
  • A to G, chromosome 3 at 96,155,237 bp
  • T to A, chromosome 4 at 118,444,063 bp
  • C to T, chromosome 4 at 155,695,117 bp
  • GGGACTCCTCCACCTCCCTGGA to GGGA, chromosome 5 at 4,755,824 bp
  • C to T, chromosome 5 at 34,458,034 bp
  • A to G, chromosome 5 at 41,795,068 bp
  • A to G, chromosome 5 at 76,594,058 bp
  • G to T, chromosome 5 at 77,401,490 bp
  • A to G, chromosome 5 at 103,843,085 bp
  • T to C, chromosome 5 at 135,134,030 bp
  • T to A, chromosome 6 at 92,887,691 bp
  • C to T, chromosome 7 at 3,913,197 bp
  • G to A, chromosome 7 at 6,060,793 bp
  • A to T, chromosome 7 at 25,233,854 bp
  • T to C, chromosome 7 at 30,659,572 bp
  • A to T, chromosome 7 at 73,471,881 bp
  • A to T, chromosome 7 at 79,842,202 bp
  • G to A, chromosome 7 at 98,125,831 bp
  • A to T, chromosome 7 at 101,827,456 bp
  • G to A, chromosome 7 at 103,155,330 bp
  • C to T, chromosome 7 at 103,173,046 bp
  • A to T, chromosome 7 at 118,915,591 bp
  • A to T, chromosome 7 at 126,891,756 bp
  • T to A, chromosome 8 at 24,914,070 bp
  • A to G, chromosome 8 at 36,102,560 bp
  • T to A, chromosome 8 at 69,228,541 bp
  • A to G, chromosome 8 at 102,658,267 bp
  • A to T, chromosome 8 at 105,357,636 bp
  • C to T, chromosome 9 at 21,279,432 bp
  • T to G, chromosome 9 at 24,695,814 bp
  • T to C, chromosome 9 at 35,221,490 bp
  • A to G, chromosome 9 at 107,983,339 bp
  • C to A, chromosome 10 at 20,352,920 bp
  • C to T, chromosome 10 at 41,479,210 bp
  • T to G, chromosome 10 at 67,219,632 bp
  • T to C, chromosome 10 at 89,669,687 bp
  • T to G, chromosome 11 at 21,271,720 bp
  • A to G, chromosome 11 at 55,311,331 bp
  • G to T, chromosome 11 at 85,234,727 bp
  • T to C, chromosome 11 at 119,028,059 bp
  • A to C, chromosome 13 at 51,677,254 bp
  • T to A, chromosome 13 at 104,205,626 bp
  • A to T, chromosome 14 at 27,898,593 bp
  • A to G, chromosome 14 at 52,667,834 bp
  • G to A, chromosome 14 at 70,704,706 bp
  • C to A, chromosome 14 at 78,627,784 bp
  • GCCTTC to GC, chromosome 14 at 79,423,491 bp
  • T to C, chromosome 15 at 38,219,559 bp
  • T to A, chromosome 16 at 4,927,664 bp
  • G to A, chromosome 16 at 17,792,750 bp
  • A to T, chromosome 16 at 48,927,790 bp
  • A to G, chromosome 16 at 49,171,909 bp
  • G to A, chromosome 16 at 87,719,291 bp
  • G to A, chromosome 17 at 13,355,934 bp
  • C to A, chromosome 17 at 25,722,678 bp
  • A to T, chromosome 17 at 29,599,869 bp
  • A to G, chromosome 17 at 35,957,511 bp
  • A to T, chromosome 18 at 65,682,898 bp
  • T to A, chromosome 19 at 38,812,345 bp
  • T to A, chromosome 19 at 46,475,588 bp
  • C to T, chromosome 19 at 53,011,765 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7095 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045243-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.