Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7095Btlr/Mmmh
Stock Number:
045243-MU
Citation ID:
RRID:MMRRC_045243-MU
Other Names:
R7095 (G1)
Major Collection:

Strain Information

Sufu
Name: SUFU negative regulator of hedgehog signaling
Synonyms: Su(Fu), 2810026F04Rik, b2b273Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24069
Homologene: 9262
Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, OB-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Secisbp2
Name: SECIS binding protein 2
Synonyms: 2210413N07Rik, SBP2, 2810012K13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75420
Homologene: 11415
Xpnpep1
Name: X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms: D230045I08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170750
Homologene: 6424
Zfp930
Name: zinc finger protein 930
Synonyms: zinc finger protein, D10627
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234358
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Dgkh
Name: diacylglycerol kinase, eta
Synonyms: 5930402B05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380921
VEGA: 14
HGNC: HGNC:2854
Homologene: 99373
Zfp532
Name: zinc finger protein 532
Synonyms: C530030I18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328977
Homologene: 138627
Aff1
Name: AF4/FMR2 family, member 1
Synonyms: Af4, Rob, 9630032B01Rik, Mllt2h
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17355
HGNC: HGNC:7135
Homologene: 4340
Appbp2
Name: amyloid beta precursor protein binding protein 2
Synonyms: PAT1, 1300003O07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66884
HGNC: HGNC:622
Homologene: 31378
Mgrn1
Name: mahogunin, ring finger 1
Synonyms: nc, 2610042J20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17237
VEGA: 16
Homologene: 41020
Inppl1
Name: inositol polyphosphate phosphatase-like 1
Synonyms: SHIP2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16332
HGNC: HGNC:6080
Homologene: 1204
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Xpo7
Name: exportin 7
Synonyms: Ranbp16, 4930506C02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65246
VEGA: 14
Homologene: 22857
Otud7b
Name: OTU domain containing 7B
Synonyms: 4930463P07Rik, 2900060B22Rik, Za20d1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229603
Homologene: 10624
Dclk2
Name: doublecortin-like kinase 2
Synonyms: 6330415M09Rik, Click-II, Dcamkl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70762
Homologene: 69431
Cep135
Name: centrosomal protein 135
Synonyms: LOC381644, Cep4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381644
Homologene: 45709
Chd2
Name: chromodomain helicase DNA binding protein 2
Synonyms: 2810040A01Rik, 2810013C04Rik, 5630401D06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244059
HGNC: HGNC:1917
Homologene: 37462
Scyl2
Name: SCY1-like 2 (S. cerevisiae)
Synonyms: D10Ertd802e, CVAK104
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213326
Homologene: 13349
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665775
Homologene: 45109
Abcf1
Name: ATP-binding cassette, sub-family F member 1
Synonyms: Abc50, D17Wsu166e, GCN20
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224742
HGNC: HGNC:70
Homologene: 849
Fam193a
Name: family with sequence homology 193, member A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231128
Homologene: 2746
Dzip3
Name: DAZ interacting protein 3, zinc finger
Synonyms: 6430549P11Rik, 2310047C04Rik, 2A-HUB
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224170
Homologene: 8771
Adam32
Name: a disintegrin and metallopeptidase domain 32
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 353188
Homologene: 17021
Dpy19l2
Name: dpy-19 like 2
Synonyms: 4932443J21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320752
VEGA: 9
Homologene: 77569
Bach1
Name: BTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms: 6230421P05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12013
HGNC: HGNC:935
Homologene: 916
Erc2
Name: ELKS/RAB6-interacting/CAST family member 2
Synonyms: D14Ertd171e, ELKS2alpha, CAST
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 238988
Homologene: 69188
Mtfr2
Name: mitochondrial fission regulator 2
Synonyms: 4933412C16Rik, 2610016C23Rik, Fam54a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71804
VEGA: 10
Homologene: 69441
Fam118b
Name: family with sequence similarity 118, member B
Synonyms: 2310022O21Rik, 2700018L24Rik, C030004A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109229
Homologene: 11584
Noc3l
Name: NOC3 like DNA replication regulator
Synonyms: Fad24
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 57753
VEGA: 19
Homologene: 39642
Gsk3a
Name: glycogen synthase kinase 3 alpha
Synonyms: 2700086H06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 606496
HGNC: HGNC:4616
Homologene: 88581
Ppwd1
Name: peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms: A330090G21Rik, 4632422M10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238831
VEGA: 13
Homologene: 9099
Mecom
Name: MDS1 and EVI1 complex locus
Synonyms: ZNFPR1B1, Prdm3, MDS1-EVI1, Evi-1, D630039M04Rik, Jbo, Evi1, Mds1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14013
HGNC: HGNC:3498
Homologene: 21086
Anpep
Name: alanyl aminopeptidase, membrane
Synonyms: Cd13, aminopeptidase N, Apn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16790
HGNC: HGNC:500
Homologene: 68163
Igfbp7
Name: insulin-like growth factor binding protein 7
Synonyms: mac25, Fstl2, AGM
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 29817
HGNC: HGNC:5476
Homologene: 1193
Slc9a5
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 5
Synonyms: LOC277973
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277973
Homologene: 31247
Myh15
Name: myosin, heavy chain 15
Synonyms: EG667772
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 667772
VEGA: 16
Homologene: 18929
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Mlxipl
Name: MLX interacting protein-like
Synonyms: WS-bHLH, ChREBP, Wbscr14, bHLHd14
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 58805
Homologene: 32507
Uba7
Name: ubiquitin-like modifier activating enzyme 7
Synonyms: 1300004C08Rik, Ube1l
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74153
Homologene: 2502
Irs1
Name: insulin receptor substrate 1
Synonyms: IRS-1, G972R
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16367
HGNC: HGNC:6125
Homologene: 4049
Haus5
Name: HAUS augmin-like complex, subunit 5
Synonyms: 2310022K01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71909
Homologene: 18969
Chtf18
Name: CTF18, chromosome transmission fidelity factor 18
Synonyms: 6030457M03Rik, CTF18
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214901
Homologene: 32532
Adamts9
Name: ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms: 1810011L16Rik, E030027K14Rik, 8430403M15Rik, Gsfund3, UND3, Mhdaund3, Mhdaund4, UND4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101401
Homologene: 18821
Ralgds
Name: ral guanine nucleotide dissociation stimulator
Synonyms: RalGDS, Rgds, Gnds
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19730
HGNC: HGNC:9842
Homologene: 4562
Fzd1
Name: frizzled class receptor 1
Synonyms: FZ-1, Fz1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14362
HGNC: HGNC:4038
Homologene: 20750
Or52s1b
Name: olfactory receptor family 52 subfamily S member 1B
Synonyms: GA_x6K02T2PBJ9-5889409-5888465, MOR24-1P, Olfr591
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258139
Homologene: 79429
Otol1
Name: otolin 1
Synonyms: LOC229389, Gm414
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229389
Homologene: 19018
Mtrf1
Name: mitochondrial translational release factor 1
Synonyms: A830062K05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211253
VEGA: 14
HGNC: HGNC:7469
Homologene: 20903
Lilra6
Name: leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Synonyms: 7M1, Pira3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18726
Homologene: 134028
Mpl
Name: myeloproliferative leukemia virus oncogene
Synonyms: c-mpl, thrombopoietin receptor, TPO-R, CD110, c-mpl-II, c-mpl-I, hlb219
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17480
HGNC: HGNC:7217
Homologene: 7845
Tdpoz3
Name: TD and POZ domain containing 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 399674
Homologene: 128308
Prag1
Name: PEAK1 related kinase activating pseudokinase 1
Synonyms: NACK, D8Ertd82e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244418
Homologene: 18256
Nlrp4c
Name: NLR family, pyrin domain containing 4C
Synonyms: Nalp-alpha, Rnh2, Nalp4c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83564
Homologene: 75315
Or5j3
Name: olfactory receptor family 5 subfamily J member 3
Synonyms: GA_x6K02T2Q125-47777498-47778436, MOR172-1, Olfr1052
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259012
Homologene: 79679
Mical1
Name: microtubule associated monooxygenase, calponin and LIM domain containing 1
Synonyms: Nical
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 171580
Homologene: 11246
Iqck
Name: IQ motif containing K
Synonyms: A230094G09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434232
Homologene: 45162
Klhl22
Name: kelch-like 22
Synonyms: 2610318I18Rik, Kelchl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224023
Homologene: 23784
Cbx2
Name: chromobox 2
Synonyms: M33
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12416
HGNC: HGNC:1552
Homologene: 7256
Mtarc1
Name: mitochondrial amidoxime reducing component 1
Synonyms: 1300013F15Rik, Mosc1, Marc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66112
Homologene: 129604
Tbc1d22b
Name: TBC1 domain family, member 22B
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381085
Homologene: 23043
Fndc10
Name: fibronectin type III domain containing 10
Synonyms: B930041F14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230991
Homologene: 130478
Tmem219
Name: transmembrane protein 219
Synonyms: 2900045G02Rik, 1110032O16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68742
Homologene: 19263
Or52e2
Name: olfactory receptor family 52 subfamily E member 2
Synonyms: GA_x6K02T2PBJ9-5871256-5870303, MOR32-3, Olfr589
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259054
Homologene: 133046
Odf1
Name: outer dense fiber of sperm tails 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18285
HGNC: HGNC:8113
Homologene: 7456
Tcp10c
Name: t-complex protein 10c
Synonyms: T66C-a, D17Leh66ca, D17Leh66C, Tcp-10c, Gm9880
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100041352
VEGA: 17
Homologene: 83254
Trav6-2
Name: T cell receptor alpha variable 6-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 436539
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 82,290,098 bp
  • A to G, chromosome 1 at 184,795,240 bp
  • A to T, chromosome 1 at 189,659,176 bp
  • C to A, chromosome 2 at 28,549,308 bp
  • C to T, chromosome 2 at 52,177,623 bp
  • C to T, chromosome 2 at 86,298,677 bp
  • T to C, chromosome 3 at 29,980,954 bp
  • G to T, chromosome 3 at 70,018,694 bp
  • C to T, chromosome 3 at 86,793,259 bp
  • T to C, chromosome 3 at 93,827,061 bp
  • A to G, chromosome 3 at 96,155,237 bp
  • T to A, chromosome 4 at 118,444,063 bp
  • C to T, chromosome 4 at 155,695,117 bp
  • GGGACTCCTCCACCTCCCTGGA to GGGA, chromosome 5 at 4,755,824 bp
  • C to T, chromosome 5 at 34,458,034 bp
  • A to G, chromosome 5 at 41,795,068 bp
  • A to G, chromosome 5 at 76,594,058 bp
  • G to T, chromosome 5 at 77,401,490 bp
  • A to G, chromosome 5 at 103,843,085 bp
  • T to C, chromosome 5 at 135,134,030 bp
  • T to A, chromosome 6 at 92,887,691 bp
  • C to T, chromosome 7 at 3,913,197 bp
  • G to A, chromosome 7 at 6,060,793 bp
  • A to T, chromosome 7 at 25,233,854 bp
  • T to C, chromosome 7 at 30,659,572 bp
  • A to T, chromosome 7 at 73,471,881 bp
  • A to T, chromosome 7 at 79,842,202 bp
  • G to A, chromosome 7 at 98,125,831 bp
  • A to T, chromosome 7 at 101,827,456 bp
  • G to A, chromosome 7 at 103,155,330 bp
  • C to T, chromosome 7 at 103,173,046 bp
  • A to T, chromosome 7 at 118,915,591 bp
  • A to T, chromosome 7 at 126,891,756 bp
  • T to A, chromosome 8 at 24,914,070 bp
  • A to G, chromosome 8 at 36,102,560 bp
  • T to A, chromosome 8 at 69,228,541 bp
  • A to G, chromosome 8 at 102,658,267 bp
  • A to T, chromosome 8 at 105,357,636 bp
  • C to T, chromosome 9 at 21,279,432 bp
  • T to G, chromosome 9 at 24,695,814 bp
  • T to C, chromosome 9 at 35,221,490 bp
  • A to G, chromosome 9 at 107,983,339 bp
  • C to A, chromosome 10 at 20,352,920 bp
  • C to T, chromosome 10 at 41,479,210 bp
  • T to G, chromosome 10 at 67,219,632 bp
  • T to C, chromosome 10 at 89,669,687 bp
  • T to G, chromosome 11 at 21,271,720 bp
  • A to G, chromosome 11 at 55,311,331 bp
  • G to T, chromosome 11 at 85,234,727 bp
  • T to C, chromosome 11 at 119,028,059 bp
  • A to C, chromosome 13 at 51,677,254 bp
  • T to A, chromosome 13 at 104,205,626 bp
  • A to T, chromosome 14 at 27,898,593 bp
  • A to G, chromosome 14 at 52,667,834 bp
  • G to A, chromosome 14 at 70,704,706 bp
  • C to A, chromosome 14 at 78,627,784 bp
  • GCCTTC to GC, chromosome 14 at 79,423,491 bp
  • T to C, chromosome 15 at 38,219,559 bp
  • T to A, chromosome 16 at 4,927,664 bp
  • G to A, chromosome 16 at 17,792,750 bp
  • A to T, chromosome 16 at 48,927,790 bp
  • A to G, chromosome 16 at 49,171,909 bp
  • G to A, chromosome 16 at 87,719,291 bp
  • G to A, chromosome 17 at 13,355,934 bp
  • C to A, chromosome 17 at 25,722,678 bp
  • A to T, chromosome 17 at 29,599,869 bp
  • A to G, chromosome 17 at 35,957,511 bp
  • A to T, chromosome 18 at 65,682,898 bp
  • T to A, chromosome 19 at 38,812,345 bp
  • T to A, chromosome 19 at 46,475,588 bp
  • C to T, chromosome 19 at 53,011,765 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7095 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045243-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.