Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7200Btlr/Mmmh
Stock Number:
045278-MU
Citation ID:
RRID:MMRRC_045278-MU
Other Names:
R7200 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Acvr1c
Name: activin A receptor, type IC
Synonyms: ALK7, Alk-7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269275
Homologene: 26724
Glrx3
Name: glutaredoxin 3
Synonyms: PKC interacting cousin of thioredoxin, PICOT, Txnl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30926
Homologene: 4769
Rnf38
Name: ring finger protein 38
Synonyms: Oip1, 1700065B19Rik, 2610202O07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73469
Homologene: 32550
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Ldlrad3
Name: low density lipoprotein receptor class A domain containing 3
Synonyms: Lrad3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241576
Homologene: 18377
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp
  • A to G, chromosome 1 at 153,785,199 bp
  • G to A, chromosome 1 at 187,112,503 bp
  • A to G, chromosome 1 at 195,163,249 bp
  • T to C, chromosome 2 at 32,364,287 bp
  • A to T, chromosome 2 at 58,315,855 bp
  • G to T, chromosome 2 at 102,113,558 bp
  • A to G, chromosome 2 at 102,113,560 bp
  • A to T, chromosome 2 at 113,291,377 bp
  • A to T, chromosome 2 at 126,639,302 bp
  • T to A, chromosome 2 at 131,561,250 bp
  • T to A, chromosome 2 at 164,215,117 bp
  • T to C, chromosome 3 at 57,672,985 bp
  • T to C, chromosome 3 at 133,487,192 bp
  • A to T, chromosome 4 at 34,645,747 bp
  • A to T, chromosome 4 at 44,137,620 bp
  • C to T, chromosome 5 at 30,145,317 bp
  • T to A, chromosome 5 at 53,144,109 bp
  • T to C, chromosome 6 at 35,287,350 bp
  • T to A, chromosome 6 at 48,620,481 bp
  • T to C, chromosome 6 at 72,606,019 bp
  • C to T, chromosome 7 at 12,710,332 bp
  • T to C, chromosome 7 at 137,464,436 bp
  • A to G, chromosome 8 at 4,311,767 bp
  • G to A, chromosome 8 at 25,241,640 bp
  • A to T, chromosome 8 at 33,322,348 bp
  • G to A, chromosome 9 at 106,072,249 bp
  • T to C, chromosome 10 at 3,956,810 bp
  • A to G, chromosome 10 at 53,615,923 bp
  • T to G, chromosome 10 at 79,270,736 bp
  • G to A, chromosome 10 at 82,151,101 bp
  • C to A, chromosome 11 at 30,998,348 bp
  • A to G, chromosome 11 at 65,153,010 bp
  • A to G, chromosome 11 at 69,364,095 bp
  • A to G, chromosome 11 at 73,239,586 bp
  • T to G, chromosome 12 at 71,140,906 bp
  • T to G, chromosome 12 at 101,689,055 bp
  • T to C, chromosome 13 at 4,081,051 bp
  • T to C, chromosome 13 at 55,608,342 bp
  • T to C, chromosome 13 at 93,691,885 bp
  • A to T, chromosome 14 at 14,175,477 bp
  • G to A, chromosome 14 at 30,682,857 bp
  • C to A, chromosome 14 at 67,771,702 bp
  • G to A, chromosome 14 at 117,964,856 bp
  • AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA to AGGGACAA, chromosome 15 at 78,966,842 bp
  • T to C, chromosome 17 at 23,761,059 bp
  • C to A, chromosome 17 at 29,319,234 bp
  • TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT to TCCTGAGGCAGTGCTGGAT, chromosome 17 at 35,622,633 bp
  • A to T, chromosome 17 at 36,081,046 bp
  • A to T, chromosome 18 at 73,930,919 bp
  • A to C, chromosome 19 at 5,156,413 bp
  • T to C, chromosome 19 at 13,095,232 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7200 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045278-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.