Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7200Btlr/Mmmh
Stock Number:
045278-MU
Citation ID:
RRID:MMRRC_045278-MU
Other Names:
R7200 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Acvr1c
Name: activin A receptor, type IC
Synonyms: ALK7, Alk-7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269275
Homologene: 26724
Glrx3
Name: glutaredoxin 3
Synonyms: PKC interacting cousin of thioredoxin, PICOT, Txnl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30926
Homologene: 4769
Rnf38
Name: ring finger protein 38
Synonyms: Oip1, 1700065B19Rik, 2610202O07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73469
Homologene: 32550
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Ldlrad3
Name: low density lipoprotein receptor class A domain containing 3
Synonyms: Lrad3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241576
Homologene: 18377
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Gabpb1
Name: GA repeat binding protein, beta 1
Synonyms: E4TF1-53, E4TF1-47, NRF2B2, NRF2B1, E4Tf1B, BABPB2, E4TF1, GABPB1-2, GABPB1-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14391
HGNC: HGNC:4074
Homologene: 7723
Tacc1
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: 4833447E04Rik, B230378H13Rik, Tacc1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320165
Homologene: 4575
Mcm9
Name: minichromosome maintenance 9 homologous recombination repair factor
Synonyms: 9030408O17Rik, Mcmdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71567
VEGA: 10
Homologene: 13546
Pacs1
Name: phosphofurin acidic cluster sorting protein 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107975
VEGA: 19
Homologene: 9970
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Plekhg1
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Synonyms: D10Ertd733e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213783
Homologene: 18897
Gpc6
Name: glypican 6
Synonyms: 6720429C22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 23888
HGNC: HGNC:4454
Homologene: 55922
Elavl1
Name: ELAV like RNA binding protein 1
Synonyms: Hua, 2410055N02Rik, W91709, HuR, ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15568
HGNC: HGNC:3312
Homologene: 20367
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
AU041133
Name: expressed sequence AU041133
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216177
Homologene: 87560
Pi16
Name: peptidase inhibitor 16
Synonyms: 1200009H11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74116
Homologene: 134317
Retsat
Name: retinol saturase (all trans retinol 13,14 reductase)
Synonyms: 0610039N19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67442
Homologene: 41195
Trpv1
Name: transient receptor potential cation channel, subfamily V, member 1
Synonyms: capsaicin receptor, VR-1, OTRPC1, Vr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193034
Homologene: 12920
Flywch1
Name: FLYWCH-type zinc finger 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224613
VEGA: 17
Homologene: 72130
Or2t6
Name: olfactory receptor family 2 subfamily T member 6
Synonyms: GA_x6K02T2PLTE-6544896-6543946, MOR274-2, Olfr720
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258387
Homologene: 74036
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Ciz1
Name: CDKN1A interacting zinc finger protein 1
Synonyms: 0610038H21Rik, 2900056O04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68379
Homologene: 8112
Mapk4
Name: mitogen-activated protein kinase 4
Synonyms: Erk3-related, p63Mapk, A330097D03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225724
HGNC: HGNC:6878
Homologene: 2058
Slc13a4
Name: solute carrier family 13 (sodium/sulfate symporters), member 4
Synonyms: SUT-1, SUT1, 9630060C05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243755
Homologene: 69125
Zfp775
Name: zinc finger protein 775
Synonyms: C130032F08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243372
Homologene: 37089
Vmn2r56
Name: vomeronasal 2, receptor 56
Synonyms: EG629079
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 629079
Homologene: 104040
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: EG235580, 1110001D15Rik, Dvwa, Vwa6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Spata17
Name: spermatogenesis associated 17
Synonyms: 4930504I07Rik, 1700065F16Rik, 4930513F16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74717
Homologene: 12551
Rgsl1
Name: regulator of G-protein signaling like 1
Synonyms: 4930415K13Rik, Rgsl2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240816
Homologene: 129962
Adra1d
Name: adrenergic receptor, alpha 1d
Synonyms: Adra1, Gpcr8, Adra1a, Adra-1, alpha1D-AR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11550
HGNC: HGNC:280
Homologene: 551
Rars2
Name: arginyl-tRNA synthetase 2, mitochondrial
Synonyms: PRO1992, 1500002I10Rik, Rarsl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109093
Homologene: 5707
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Cr2
Name: complement receptor 2
Synonyms: CD21, CD35, Cr-1, Cr-2, Cr1, C3DR
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Vmn2r81
Name: vomeronasal 2, receptor 81
Synonyms: pheromone recepter, EC1-VR2, V2rf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216144
Homologene: 83483
H2-Bl
Name: histocompatibility 2, blastocyst
Synonyms: blastocyst MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14963
Homologene: 128352
Or5b104
Name: olfactory receptor family 5 subfamily B member 104
Synonyms: GA_x6K02T2RE5P-3423041-3422097, MOR202-20, Olfr1457
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258568
HGNC: HGNC:8324
Homologene: 133676
Ankub1
Name: ankyrin repeat and ubiquitin domain containing 1
Synonyms: LOC242037, Gm410
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242037
Homologene: 54680
Tc2n
Name: tandem C2 domains, nuclear
Synonyms: 4933406D09Rik, Tac2-N, Mtac2d1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74413
Homologene: 12560
Akr1c14
Name: aldo-keto reductase family 1, member C14
Synonyms: 9030611N15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105387
Homologene: 138093
Asb3
Name: ankyrin repeat and SOCS box-containing 3
Synonyms: 2400011J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 65257
Homologene: 9391
Dmgdh
Name: dimethylglycine dehydrogenase precursor
Synonyms: 1200014D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74129
Homologene: 8372
Hadha
Name: hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha
Synonyms: Mtpa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 97212
HGNC: HGNC:4801
Homologene: 152
Tmco5b
Name: transmembrane and coiled-coil domains 5B
Synonyms: 4930563P21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75275
Homologene: 52839
Wfdc15b
Name: WAP four-disulfide core domain 15B
Synonyms: Swam1, 9230106L14Rik, Wfdc15
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192201
Homologene: 77219
B4galt7
Name: beta-1,4-galactosyltransferase 7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218271
HGNC: HGNC:930
Homologene: 5248
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp
  • A to G, chromosome 1 at 153,785,199 bp
  • G to A, chromosome 1 at 187,112,503 bp
  • A to G, chromosome 1 at 195,163,249 bp
  • T to C, chromosome 2 at 32,364,287 bp
  • A to T, chromosome 2 at 58,315,855 bp
  • G to T, chromosome 2 at 102,113,558 bp
  • A to G, chromosome 2 at 102,113,560 bp
  • A to T, chromosome 2 at 113,291,377 bp
  • A to T, chromosome 2 at 126,639,302 bp
  • T to A, chromosome 2 at 131,561,250 bp
  • T to A, chromosome 2 at 164,215,117 bp
  • T to C, chromosome 3 at 57,672,985 bp
  • T to C, chromosome 3 at 133,487,192 bp
  • A to T, chromosome 4 at 34,645,747 bp
  • A to T, chromosome 4 at 44,137,620 bp
  • C to T, chromosome 5 at 30,145,317 bp
  • T to A, chromosome 5 at 53,144,109 bp
  • T to C, chromosome 6 at 35,287,350 bp
  • T to A, chromosome 6 at 48,620,481 bp
  • T to C, chromosome 6 at 72,606,019 bp
  • C to T, chromosome 7 at 12,710,332 bp
  • T to C, chromosome 7 at 137,464,436 bp
  • A to G, chromosome 8 at 4,311,767 bp
  • G to A, chromosome 8 at 25,241,640 bp
  • A to T, chromosome 8 at 33,322,348 bp
  • G to A, chromosome 9 at 106,072,249 bp
  • T to C, chromosome 10 at 3,956,810 bp
  • A to G, chromosome 10 at 53,615,923 bp
  • T to G, chromosome 10 at 79,270,736 bp
  • G to A, chromosome 10 at 82,151,101 bp
  • C to A, chromosome 11 at 30,998,348 bp
  • A to G, chromosome 11 at 65,153,010 bp
  • A to G, chromosome 11 at 69,364,095 bp
  • A to G, chromosome 11 at 73,239,586 bp
  • T to G, chromosome 12 at 71,140,906 bp
  • T to G, chromosome 12 at 101,689,055 bp
  • T to C, chromosome 13 at 4,081,051 bp
  • T to C, chromosome 13 at 55,608,342 bp
  • T to C, chromosome 13 at 93,691,885 bp
  • A to T, chromosome 14 at 14,175,477 bp
  • G to A, chromosome 14 at 30,682,857 bp
  • C to A, chromosome 14 at 67,771,702 bp
  • G to A, chromosome 14 at 117,964,856 bp
  • AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA to AGGGACAA, chromosome 15 at 78,966,842 bp
  • T to C, chromosome 17 at 23,761,059 bp
  • C to A, chromosome 17 at 29,319,234 bp
  • TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT to TCCTGAGGCAGTGCTGGAT, chromosome 17 at 35,622,633 bp
  • A to T, chromosome 17 at 36,081,046 bp
  • A to T, chromosome 18 at 73,930,919 bp
  • A to C, chromosome 19 at 5,156,413 bp
  • T to C, chromosome 19 at 13,095,232 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7200 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045278-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.