Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7348Btlr/Mmmh
Stock Number:
045380-MU
Citation ID:
RRID:MMRRC_045380-MU
Other Names:
R7348 (G1)
Major Collection:

Strain Information

S1pr1
Name: sphingosine-1-phosphate receptor 1
Synonyms: S1P1, S1P, Edg1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13609
HGNC: HGNC:3165
Homologene: 1071
Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Ap4e1
Name: adaptor-related protein complex AP-4, epsilon 1
Synonyms: 2310033A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108011
HGNC: HGNC:573
Homologene: 22397
Bmp6
Name: bone morphogenetic protein 6
Synonyms: Vgr1, D13Wsu115e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12161
VEGA: 13
HGNC: HGNC:1073
Homologene: 1300
Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Pygb
Name: brain glycogen phosphorylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110078
HGNC: HGNC:9723
Homologene: 100930
Agtrap
Name: angiotensin II, type I receptor-associated protein
Synonyms: Atrap, D4Wsu124e, 3300002E14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11610
Homologene: 7621
Zfp704
Name: zinc finger protein 704
Synonyms: Gig1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170753
Homologene: 64370
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Usp28
Name: ubiquitin specific peptidase 28
Synonyms: 9830148O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235323
VEGA: 9
Homologene: 10840
E2f7
Name: E2F transcription factor 7
Synonyms: A630014C11Rik, D10Ertd739e, E2F7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52679
Homologene: 18685
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Vcl
Name: vinculin
Synonyms: metavinculin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22330
VEGA: 14
Homologene: 7594
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Arih1
Name: ariadne RBR E3 ubiquitin protein ligase 1
Synonyms: UIP77
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23806
HGNC: HGNC:689
Homologene: 111871
Wwox
Name: WW domain-containing oxidoreductase
Synonyms: WOX1, 9030416C10Rik, 5330426P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80707
Homologene: 56334
Tbcd
Name: tubulin-specific chaperone d
Synonyms: A030005L14Rik, 2310057L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108903
Homologene: 4368
Ufd1
Name: ubiquitin recognition factor in ER-associated degradation 1
Synonyms: Ufd1, Ufd1l
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22230
Homologene: 39090
Copa
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12847
HGNC: HGNC:2230
Homologene: 3218
Parg
Name: poly (ADP-ribose) glycohydrolase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26430
HGNC: HGNC:8605
Homologene: 50532
Lrp6
Name: low density lipoprotein receptor-related protein 6
Synonyms: skam26Jus, Cd, ska26, skax26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16974
HGNC: HGNC:6698
Homologene: 1747
Skic3
Name: SKI3 subunit of superkiller complex
Synonyms: Ttc37
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Mlh3
Name: mutL homolog 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217716
VEGA: 12
HGNC: HGNC:7128
Homologene: 91153
Mrgpra1
Name: MAS-related GPR, member A1
Synonyms: MrgA1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233221
Homologene: 79615
Zbtb2
Name: zinc finger and BTB domain containing 2
Synonyms: LOC381990
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 381990
VEGA: 10
Homologene: 10837
Ms4a6d
Name: membrane-spanning 4-domains, subfamily A, member 6D
Synonyms: Ms4a11
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68774
Homologene: 130755
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: Mpr300, CI-MPR, IGF-II/CI-MPR, M6P/IGF2R, CD222, mannose-6-phosphate receptor, cation independent
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Ankrd26
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232339
Homologene: 45968
Tmem207
Name: transmembrane protein 207
Synonyms: LOC224058, 100043057
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100043057
VEGA: 16
Homologene: 52611
Nr4a3
Name: nuclear receptor subfamily 4, group A, member 3
Synonyms: TEC, NOR-1, Nor1, MINOR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18124
HGNC: HGNC:7982
Homologene: 5074
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Nlrp4a
Name: NLR family, pyrin domain containing 4A
Synonyms: Nalp-eta, E330028A19Rik, Nalp4a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243880
Homologene: 79696
Nkpd1
Name: NTPase, KAP family P-loop domain containing 1
Synonyms: 2310015G09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69547
Homologene: 18876
Atp1a3
Name: ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms: Atpa-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232975
HGNC: HGNC:801
Homologene: 113729
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5c, Nav1.5, mH1, SkM2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Ifi207
Name: interferon activated gene 207
Synonyms: AI607873, Pyhin-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226691
HGNC: HGNC:5395
Homologene: 115929
Adcy2
Name: adenylate cyclase 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210044
VEGA: 13
HGNC: HGNC:233
Homologene: 75133
Ccdc39
Name: coiled-coil domain containing 39
Synonyms: 4921507O14Rik, D3Ertd789e, b2b1735Clo, b2b1304Clo, b2b2025.1Clo, prh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 51938
Homologene: 12149
Haus5
Name: HAUS augmin-like complex, subunit 5
Synonyms: 2310022K01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71909
Homologene: 18969
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234353
Homologene: 87257
Izumo3
Name: IZUMO family member 3
Synonyms: 1700011H22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69314
Homologene: 122080
Ttc41
Name: tetratricopeptide repeat domain 41
Synonyms: Gnn, BC030307
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103220
VEGA: 10
Homologene: 52968
Tns1
Name: tensin 1
Synonyms: 1200014E20Rik, E030018G17Rik, 1110018I21Rik, Tns, E030037J05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21961
Homologene: 11219
Psd2
Name: pleckstrin and Sec7 domain containing 2
Synonyms: 6330404E20Rik, EFA6C
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74002
Homologene: 12522
Zfp628
Name: zinc finger protein 628
Synonyms: Zec
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232816
Homologene: 72200
Cep89
Name: centrosomal protein 89
Synonyms: 2610507L03Rik, Ccdc123
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72140
Homologene: 12444
Or5p1
Name: olfactory receptor family 5 subfamily P member 1
Synonyms: GA_x6K02T2PBJ9-10646917-10647849, MOR204-11, Olfr491
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258731
Homologene: 128150
Or7a38
Name: olfactory receptor family 7 subfamily A member 38
Synonyms: GA_x6K02T03FR9-4826-3919, GA_x6K02T2QGN0-2895081-2894349, MOR185-8, MOR139-7, MOR139-5, EG257869, Olfr233-ps1, Olfr1354
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 259163
Homologene: 136441
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Ccdc66
Name: coiled-coil domain containing 66
Synonyms: E230015L20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 320234
VEGA: 14
Homologene: 35309
Sel1l2
Name: sel-1 suppressor of lin-12-like 2 (C. elegans)
Synonyms: LOC228684
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228684
Homologene: 16802
H6pd
Name: hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Synonyms: Gpd-1, Gpd1, G6pd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100198
HGNC: HGNC:4795
Homologene: 48275
Skint1
Name: selection and upkeep of intraepithelial T cells 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639781
Homologene: 87538
Zhx3
Name: zinc fingers and homeoboxes 3
Synonyms: 4932418O04Rik, 1810059C13Rik, 9530010N21Rik, Tix1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320799
Homologene: 9000
Fastkd5
Name: FAST kinase domains 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 380601
Homologene: 36400
Skint11
Name: selection and upkeep of intraepithelial T cells 11
Synonyms: A630098G03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230623
Homologene: 136292
Vmn1r120
Name: vomeronasal 1 receptor 120
Synonyms: Gm5730
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435953
Homologene: 104166
Rftn1
Name: raftlin lipid raft linker 1
Synonyms: 2310015N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76438
Homologene: 18745
Cyp2j8
Name: cytochrome P450, family 2, subfamily j, polypeptide 8
Synonyms: OTTMUSG00000007938, Cyp2j8-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665095
HGNC: HGNC:2634
Homologene: 133819
Cyp2t4
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384724
Homologene: 76639
Rbfox1
Name: RNA binding protein, fox-1 homolog (C. elegans) 1
Synonyms: A2bp, HRNBP1, FOX1, A2bp1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268859
VEGA: 16
Homologene: 69339
Tgoln1
Name: trans-golgi network protein
Synonyms: TGN38A, TGN38, Ttgn1, D6Ertd384e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22134
Homologene: 137224
Ap5s1
Name: adaptor-related protein 5 complex, sigma 1 subunit
Synonyms: 0610038L13Rik, 2310035K24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69596
Homologene: 23095
Tas2r134
Name: taste receptor, type 2, member 134
Synonyms: Tas2r34, T2R134
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 387511
Homologene: 66001
Or5p64
Name: olfactory receptor family 5 subfamily P member 64
Synonyms: GA_x6K02T2PBJ9-10586187-10585243, MOR204-15, Olfr488
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258727
Homologene: 110483
Adpgk
Name: ADP-dependent glucokinase
Synonyms: 2610017G09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72141
VEGA: 9
Homologene: 41739
Cln6
Name: ceroid-lipofuscinosis, neuronal 6
Synonyms: 1810065L06Rik, D9Bwg1455e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76524
HGNC: HGNC:2077
Homologene: 9898
Or2f1
Name: olfactory receptor family 2 subfamily F member 1
Synonyms: GA_x6K02T2P3E9-4815856-4814903, MOR257-8P, Olfr453
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258016
Homologene: 128151
Mapre3
Name: microtubule-associated protein, RP/EB family, member 3
Synonyms: EB3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100732
HGNC: HGNC:6892
Homologene: 56565
Zfp362
Name: zinc finger protein 362
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230761
Homologene: 77409
Tmem184a
Name: transmembrane protein 184a
Synonyms: Sdmg1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231832
Homologene: 64815
Abra
Name: actin-binding Rho activating protein
Synonyms: C130068O12Rik, STARS
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223513
VEGA: 15
Homologene: 34713
Gm17018
Name: predicted gene 17018
Type: Gene
Species: Mouse
Chromosome: 19
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 73,916,917 bp
  • A to G, chromosome 1 at 172,102,223 bp
  • CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG to CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG, chromosome 1 at 173,729,196 bp
  • T to C, chromosome 2 at 51,628,402 bp
  • A to T, chromosome 2 at 127,061,976 bp
  • G to T, chromosome 2 at 127,061,977 bp
  • A to G, chromosome 2 at 130,615,135 bp
  • A to C, chromosome 2 at 130,616,439 bp
  • A to T, chromosome 2 at 131,212,652 bp
  • T to C, chromosome 2 at 140,265,724 bp
  • C to T, chromosome 2 at 150,786,983 bp
  • G to T, chromosome 2 at 160,782,118 bp
  • A to G, chromosome 3 at 9,474,598 bp
  • A to G, chromosome 3 at 33,832,676 bp
  • A to G, chromosome 3 at 115,712,061 bp
  • A to T, chromosome 3 at 148,817,766 bp
  • T to G, chromosome 4 at 48,051,290 bp
  • T to C, chromosome 4 at 92,147,218 bp
  • C to A, chromosome 4 at 96,444,640 bp
  • T to C, chromosome 4 at 112,021,573 bp
  • T to A, chromosome 4 at 114,244,722 bp
  • T to C, chromosome 4 at 128,777,217 bp
  • G to T, chromosome 4 at 148,080,597 bp
  • C to A, chromosome 4 at 149,983,902 bp
  • T to C, chromosome 5 at 30,861,829 bp
  • T to C, chromosome 5 at 139,814,054 bp
  • T to C, chromosome 6 at 42,744,856 bp
  • G to C, chromosome 6 at 72,616,278 bp
  • A to G, chromosome 6 at 118,508,564 bp
  • G to T, chromosome 6 at 134,450,818 bp
  • G to A, chromosome 7 at 4,921,818 bp
  • G to A, chromosome 7 at 19,524,416 bp
  • A to T, chromosome 7 at 21,053,452 bp
  • A to G, chromosome 7 at 24,978,826 bp
  • A to G, chromosome 7 at 26,444,273 bp
  • A to G, chromosome 7 at 27,157,251 bp
  • G to T, chromosome 7 at 30,656,966 bp
  • G to A, chromosome 7 at 35,429,928 bp
  • T to C, chromosome 7 at 47,335,409 bp
  • A to T, chromosome 7 at 49,910,167 bp
  • T to C, chromosome 7 at 108,256,123 bp
  • T to C, chromosome 7 at 108,317,713 bp
  • T to C, chromosome 8 at 67,790,931 bp
  • T to C, chromosome 8 at 112,665,277 bp
  • T to A, chromosome 8 at 114,472,652 bp
  • A to G, chromosome 9 at 49,030,877 bp
  • A to G, chromosome 9 at 59,313,786 bp
  • T to C, chromosome 9 at 59,486,058 bp
  • A to G, chromosome 9 at 62,849,176 bp
  • T to C, chromosome 9 at 119,535,833 bp
  • T to C, chromosome 10 at 4,374,574 bp
  • A to G, chromosome 10 at 12,748,018 bp
  • A to G, chromosome 10 at 78,917,562 bp
  • G to T, chromosome 10 at 86,750,348 bp
  • C to T, chromosome 10 at 110,780,975 bp
  • C to A, chromosome 11 at 67,202,539 bp
  • T to A, chromosome 11 at 79,536,850 bp
  • C to A, chromosome 11 at 121,594,311 bp
  • G to T, chromosome 12 at 85,267,441 bp
  • T to C, chromosome 13 at 38,485,903 bp
  • T to A, chromosome 13 at 68,734,675 bp
  • T to C, chromosome 13 at 76,182,884 bp
  • C to T, chromosome 14 at 21,003,150 bp
  • T to A, chromosome 14 at 21,008,952 bp
  • C to T, chromosome 14 at 27,500,336 bp
  • G to A, chromosome 14 at 32,250,079 bp
  • A to T, chromosome 14 at 54,952,259 bp
  • G to A, chromosome 15 at 41,866,159 bp
  • C to A, chromosome 16 at 7,408,024 bp
  • T to G, chromosome 16 at 18,815,885 bp
  • C to A, chromosome 16 at 26,516,827 bp
  • A to G, chromosome 17 at 12,703,484 bp
  • A to T, chromosome 17 at 46,510,993 bp
  • A to G, chromosome 17 at 50,004,323 bp
  • T to A, chromosome 18 at 4,340,561 bp
  • A to G, chromosome 18 at 25,090,467 bp
  • G to A, chromosome 18 at 35,980,336 bp
  • G to A, chromosome 19 at 11,590,073 bp
  • A to T, chromosome 19 at 17,456,818 bp
  • A to G, chromosome 19 at 45,572,466 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7348 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045380-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.