Strain Name:
C57BL/6J-MtgxR7288Btlr/Mmmh
Stock Number:
045395-MU
Citation ID:
RRID:MMRRC_045395-MU
Other Names:
R7288 (G1)
Major Collection:

Strain Information

Cdk6
Name: cyclin dependent kinase 6
Synonyms: Crk2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12571
HGNC: HGNC:1777
Homologene: 963
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: Whi, GENA 60, GENA 47, Gena 52, Cyn, Cycn, Dz, WBE1, Edy, Flo, Lda, Mt, Obt, Todo, A730019I05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Oxr1
Name: oxidation resistance 1
Synonyms: C7, 2210416C20Rik, C7B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Mtg2
Name: mitochondrial ribosome associated GTPase 2
Synonyms: Gtpbp5, D2Bwg0647e, 2900056P18Rik, 1810011P19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 52856
Homologene: 9233
Nacc1
Name: nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Synonyms: 4930511N13Rik, Nac1, Btbd14b, 2010001H03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66830
VEGA: 8
Homologene: 12042
Ung
Name: uracil DNA glycosylase
Synonyms: UNG1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22256
Homologene: 6585
Pkm
Name: pyruvate kinase, muscle
Synonyms: Pk-2, Pkm2, Pk-3, Pk3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18746
VEGA: 9
HGNC: HGNC:9021
Homologene: 37650
Slc45a4
Name: solute carrier family 45, member 4
Synonyms: 9330175B01Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106068
Homologene: 69908
Lamb2
Name: laminin, beta 2
Synonyms: Lams, npht, Lamb-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16779
HGNC: HGNC:6487
Homologene: 1723
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Rad50l, Mrell
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: TR7, Death receptor 6, DR6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 94185
VEGA: 17
Homologene: 8696
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Tmem259
Name: transmembrane protein 259
Synonyms: ORF61, membralin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216157
Homologene: 14122
Akt1s1
Name: AKT1 substrate 1
Synonyms: Lobe, PRAS40, 1110012J22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67605
Homologene: 12162
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: Crpd, CRP-[a], ebnerin, hensin, MUCLIN, gp300, vomeroglandin, CRP-[b]
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Crygb
Name: crystallin, gamma B
Synonyms: DGcry-3, Cryg-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12965
HGNC: HGNC:2409
Homologene: 3816
Iqgap3
Name: IQ motif containing GTPase activating protein 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 404710
Homologene: 26400
Zfp369
Name: zinc finger protein 369
Synonyms: B930030B22Rik, NRIF2, D230020H11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 170936
Homologene: 129707
Zfp981
Name: zinc finger protein 981
Synonyms: Gm13247
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041433
Homologene: 133076
2810021J22Rik
Name: RIKEN cDNA 2810021J22 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69944
Homologene: 138400
Tbl2
Name: transducin (beta)-like 2
Synonyms: C76179, WS-bTRP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27368
Homologene: 8260
Copg2
Name: coatomer protein complex, subunit gamma 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54160
HGNC: HGNC:2237
Homologene: 56292
Mettl8
Name: methyltransferase 8, methylcytidine
Synonyms: TIP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228019
Homologene: 11706
Tbc1d32
Name: TBC1 domain family, member 32
Synonyms: b2b2284Clo, Bromi, D630037F22Rik, C6orf170
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544696
VEGA: 10
Homologene: 51889
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276919
Homologene: 69193
Dnph1
Name: 2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Synonyms: Rcl, c-Myc-responsive, BC048355
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381101
VEGA: 17
Homologene: 4704
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: Ndap7, 2510012P17Rik, NDAP, 4930534E15Rik, CGI-06
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Plxna2
Name: plexin A2
Synonyms: Plxn2, 2810428A13Rik, OCT, PlexA2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Ift172
Name: intraflagellar transport 172
Synonyms: wim, 4930553F24Rik, avc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67661
Homologene: 15202
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Cyp4f18
Name: cytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms: 1810054N16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72054
Homologene: 128623
Dnai3
Name: dynein axonemal intermediate chain 3
Synonyms: 4931433A13Rik, IC140, Wdr63, Ida7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242253
Homologene: 44922
Fat3
Name: FAT atypical cadherin 3
Synonyms: D430038H04Rik, LOC382129, 9430076A06Rik, LOC234973
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Khdrbs3
Name: KH domain containing, RNA binding, signal transduction associated 3
Synonyms: Salp, SLM-2, Etle, T-STAR
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13992
VEGA: 15
Homologene: 4780
Or7e175
Name: olfactory receptor family 7 subfamily E member 175
Synonyms: GA_x6K02T2PVTD-13878275-13879204, MOR145-6, Olfr869
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258550
HGNC: HGNC:8396
Homologene: 138312
Slc8a3
Name: solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms: Ncx3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110893
Homologene: 62645
Zfp770
Name: zinc finger protein 770
Synonyms: 6430601A21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228491
Homologene: 82354
Cgnl1
Name: cingulin-like 1
Synonyms: Jacop, 4933421H10Rik, 9930020M10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68178
Homologene: 41901
Vmn1r195
Name: vomeronasal 1 receptor 195
Synonyms: V1ri6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171257
Homologene: 110880
Evpl
Name: envoplakin
Synonyms: 210kDa protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14027
HGNC: HGNC:3503
Homologene: 1506
Serpinb9c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9c
Synonyms: NK9, 3830421J05Rik, Spi11, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20707
HGNC: HGNC:8955
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Wdsub1
Name: WD repeat, SAM and U-box domain containing 1
Synonyms: 1700048E19Rik, 2610014F08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72137
Homologene: 17609
Rad21
Name: RAD21 cohesin complex component
Synonyms: SCC1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19357
VEGA: 15
HGNC: HGNC:9811
Homologene: 38161
Pcdhb12
Name: protocadherin beta 12
Synonyms: Pcdh3, Pcdhb5F, PcdhbL
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93883
HGNC: HGNC:8690
Homologene: 87126
Ppp2r3a
Name: protein phosphatase 2, regulatory subunit B'', alpha
Synonyms: 3222402P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235542
HGNC: HGNC:9307
Homologene: 20595
Dhx34
Name: DExH-box helicase 34
Synonyms: 1810012L18Rik, 1200013B07Rik, Ddx34
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71723
Homologene: 69171
Tchp
Name: trichoplein, keratin filament binding
Synonyms: A930031F18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77832
Homologene: 12686
Gal3st1
Name: galactose-3-O-sulfotransferase 1
Synonyms: GalCer sulfotransferase, Gcst, galactosylceramide sulfotransferase, Cst, 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53897
Homologene: 3574
Tfap2d
Name: transcription factor AP-2, delta
Synonyms: Tcfap2d
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226896
Homologene: 17700
Adh1
Name: alcohol dehydrogenase 1 (class I)
Synonyms: Adh1-e, Adh-1t, ADH-AA, class I alcohol dehydrogenase, Adh-1-t, Adh1-t, Adh-1e, Adh-1, Adh1tl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11522
Homologene: 73888
Mrgprb3
Name: MAS-related GPR, member B3
Synonyms: MrgB3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404238
Homologene: 138632
Thrb
Name: thyroid hormone receptor beta
Synonyms: Nr1a2, c-erbAbeta, T3Rbeta, T3R[b], Thrb1, TR beta, Thrb2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21834
Homologene: 36025
Zhx3
Name: zinc fingers and homeoboxes 3
Synonyms: 1810059C13Rik, Tix1, 9530010N21Rik, 4932418O04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320799
Homologene: 9000
Fhit
Name: fragile histidine triad gene
Synonyms: Fra14A2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14198
HGNC: HGNC:3701
Homologene: 21661
Hecw1
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Synonyms: NEDL1, E130207I19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94253
VEGA: 13
Homologene: 9004
Slc17a2
Name: solute carrier family 17 (sodium phosphate), member 2
Synonyms: C730032N17Rik, NPT3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218103
Homologene: 4260
Bpifc
Name: BPI fold containing family C
Synonyms: Bpil2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270757
Homologene: 18383
Or13a26
Name: olfactory receptor family 13 subfamily A member 26
Synonyms: GA_x6K02T2PBJ9-42850324-42851256, MOR253-3, Olfr541
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258964
Homologene: 138322
Bend7
Name: BEN domain containing 7
Synonyms: 1110017O21Rik, E130319B15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209645
Homologene: 17660
Rabep2
Name: rabaptin, RAB GTPase binding effector protein 2
Synonyms: 2610011A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70314
Homologene: 23489
Ppil6
Name: peptidylprolyl isomerase (cyclophilin)-like 6
Synonyms: 2900084F20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73075
VEGA: 10
Homologene: 52155
Tmtc2
Name: transmembrane and tetratricopeptide repeat containing 2
Synonyms: D330034A10Rik, 8430438D04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 278279
Homologene: 25521
Esrra
Name: estrogen related receptor, alpha
Synonyms: Estrra, ERRalpha, Err1, Nr3b1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 26379
HGNC: HGNC:3471
Homologene: 20941
Trib1
Name: tribbles pseudokinase 1
Synonyms: Trb1, A530090O15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 211770
Homologene: 75216
Ighv7-3
Name: immunoglobulin heavy variable 7-3
Synonyms: Gm16842
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 629822
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 19,118,983 bp
  • A to G, chromosome 1 at 65,081,925 bp
  • A to T, chromosome 1 at 82,492,463 bp
  • T to A, chromosome 1 at 194,796,919 bp
  • C to T, chromosome 2 at 4,752,830 bp
  • A to T, chromosome 2 at 59,878,143 bp
  • A to T, chromosome 2 at 70,982,038 bp
  • G to T, chromosome 2 at 114,195,661 bp
  • A to C, chromosome 2 at 160,781,122 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to G, chromosome 2 at 180,083,387 bp
  • T to A, chromosome 3 at 88,108,835 bp
  • T to A, chromosome 3 at 88,965,892 bp
  • T to G, chromosome 3 at 138,282,732 bp
  • T to C, chromosome 3 at 146,081,252 bp
  • C to T, chromosome 4 at 6,416,641 bp
  • C to T, chromosome 4 at 8,847,093 bp
  • C to T, chromosome 4 at 146,537,643 bp
  • T to A, chromosome 5 at 3,429,001 bp
  • T to C, chromosome 5 at 31,285,286 bp
  • T to A, chromosome 5 at 114,131,254 bp
  • A to C, chromosome 5 at 114,715,569 bp
  • T to A, chromosome 5 at 135,154,399 bp
  • T to A, chromosome 6 at 30,824,406 bp
  • A to G, chromosome 7 at 16,215,436 bp
  • T to C, chromosome 7 at 44,849,147 bp
  • C to A, chromosome 7 at 48,643,311 bp
  • C to T, chromosome 7 at 126,444,205 bp
  • C to T, chromosome 7 at 131,083,789 bp
  • T to A, chromosome 7 at 140,705,029 bp
  • A to T, chromosome 8 at 71,993,173 bp
  • C to T, chromosome 8 at 84,676,545 bp
  • T to C, chromosome 9 at 15,998,592 bp
  • T to A, chromosome 9 at 20,137,441 bp
  • A to G, chromosome 9 at 59,668,913 bp
  • A to T, chromosome 9 at 71,725,564 bp
  • T to C, chromosome 9 at 101,127,004 bp
  • A to T, chromosome 9 at 108,488,324 bp
  • C to G, chromosome 10 at 41,498,528 bp
  • A to C, chromosome 10 at 56,051,387 bp
  • A to T, chromosome 10 at 79,978,466 bp
  • T to C, chromosome 10 at 85,988,721 bp
  • T to C, chromosome 10 at 105,413,608 bp
  • A to T, chromosome 11 at 3,998,609 bp
  • T to A, chromosome 11 at 3,998,651 bp
  • G to T, chromosome 11 at 53,654,949 bp
  • T to A, chromosome 11 at 58,880,305 bp
  • A to T, chromosome 11 at 76,213,380 bp
  • T to C, chromosome 11 at 116,223,949 bp
  • T to A, chromosome 12 at 81,216,824 bp
  • C to T, chromosome 12 at 114,153,343 bp
  • T to C, chromosome 13 at 14,316,236 bp
  • G to T, chromosome 13 at 22,279,004 bp
  • C to A, chromosome 13 at 23,819,112 bp
  • C to T, chromosome 13 at 33,151,900 bp
  • T to G, chromosome 13 at 65,285,018 bp
  • T to A, chromosome 14 at 9,763,784 bp
  • T to A, chromosome 14 at 18,030,186 bp
  • C to T, chromosome 15 at 41,813,608 bp
  • A to T, chromosome 15 at 51,982,580 bp
  • T to C, chromosome 15 at 59,654,622 bp
  • A to G, chromosome 15 at 69,049,413 bp
  • C to A, chromosome 15 at 73,586,936 bp
  • A to G, chromosome 17 at 25,846,312 bp
  • A to G, chromosome 17 at 43,037,818 bp
  • A to G, chromosome 17 at 46,499,012 bp
  • T to A, chromosome 18 at 37,436,015 bp
  • A to T, chromosome 19 at 6,912,771 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7288 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045395-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.