Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7288Btlr/Mmmh
Stock Number:
045395-MU
Citation ID:
RRID:MMRRC_045395-MU
Other Names:
R7288 (G1)
Major Collection:

Strain Information

Cdk6
Name: cyclin dependent kinase 6
Synonyms: Crk2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12571
HGNC: HGNC:1777
Homologene: 963
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Oxr1
Name: oxidation resistance 1
Synonyms: C7B, C7, 2210416C20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Mtg2
Name: mitochondrial ribosome associated GTPase 2
Synonyms: 1810011P19Rik, D2Bwg0647e, 2900056P18Rik, Gtpbp5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 52856
Homologene: 9233
Nacc1
Name: nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Synonyms: Nac1, 4930511N13Rik, 2010001H03Rik, Btbd14b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66830
VEGA: 8
Homologene: 12042
Ung
Name: uracil DNA glycosylase
Synonyms: UNG1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22256
Homologene: 6585
Pkm
Name: pyruvate kinase, muscle
Synonyms: Pk-3, Pk-2, Pk3, Pkm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18746
VEGA: 9
HGNC: HGNC:9021
Homologene: 37650
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 19,118,983 bp
  • A to G, chromosome 1 at 65,081,925 bp
  • A to T, chromosome 1 at 82,492,463 bp
  • T to A, chromosome 1 at 194,796,919 bp
  • C to T, chromosome 2 at 4,752,830 bp
  • A to T, chromosome 2 at 59,878,143 bp
  • A to T, chromosome 2 at 70,982,038 bp
  • G to T, chromosome 2 at 114,195,661 bp
  • A to C, chromosome 2 at 160,781,122 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to G, chromosome 2 at 180,083,387 bp
  • T to A, chromosome 3 at 88,108,835 bp
  • T to A, chromosome 3 at 88,965,892 bp
  • T to G, chromosome 3 at 138,282,732 bp
  • T to C, chromosome 3 at 146,081,252 bp
  • C to T, chromosome 4 at 6,416,641 bp
  • C to T, chromosome 4 at 8,847,093 bp
  • C to T, chromosome 4 at 146,537,643 bp
  • T to A, chromosome 5 at 3,429,001 bp
  • T to C, chromosome 5 at 31,285,286 bp
  • T to A, chromosome 5 at 114,131,254 bp
  • A to C, chromosome 5 at 114,715,569 bp
  • T to A, chromosome 5 at 135,154,399 bp
  • T to A, chromosome 6 at 30,824,406 bp
  • A to G, chromosome 7 at 16,215,436 bp
  • T to C, chromosome 7 at 44,849,147 bp
  • C to A, chromosome 7 at 48,643,311 bp
  • C to T, chromosome 7 at 126,444,205 bp
  • C to T, chromosome 7 at 131,083,789 bp
  • T to A, chromosome 7 at 140,705,029 bp
  • A to T, chromosome 8 at 71,993,173 bp
  • C to T, chromosome 8 at 84,676,545 bp
  • T to C, chromosome 9 at 15,998,592 bp
  • T to A, chromosome 9 at 20,137,441 bp
  • A to G, chromosome 9 at 59,668,913 bp
  • A to T, chromosome 9 at 71,725,564 bp
  • T to C, chromosome 9 at 101,127,004 bp
  • A to T, chromosome 9 at 108,488,324 bp
  • C to G, chromosome 10 at 41,498,528 bp
  • A to C, chromosome 10 at 56,051,387 bp
  • A to T, chromosome 10 at 79,978,466 bp
  • T to C, chromosome 10 at 85,988,721 bp
  • T to C, chromosome 10 at 105,413,608 bp
  • A to T, chromosome 11 at 3,998,609 bp
  • T to A, chromosome 11 at 3,998,651 bp
  • G to T, chromosome 11 at 53,654,949 bp
  • T to A, chromosome 11 at 58,880,305 bp
  • A to T, chromosome 11 at 76,213,380 bp
  • T to C, chromosome 11 at 116,223,949 bp
  • T to A, chromosome 12 at 81,216,824 bp
  • C to T, chromosome 12 at 114,153,343 bp
  • T to C, chromosome 13 at 14,316,236 bp
  • G to T, chromosome 13 at 22,279,004 bp
  • C to A, chromosome 13 at 23,819,112 bp
  • C to T, chromosome 13 at 33,151,900 bp
  • T to G, chromosome 13 at 65,285,018 bp
  • T to A, chromosome 14 at 9,763,784 bp
  • T to A, chromosome 14 at 18,030,186 bp
  • C to T, chromosome 15 at 41,813,608 bp
  • A to T, chromosome 15 at 51,982,580 bp
  • T to C, chromosome 15 at 59,654,622 bp
  • A to G, chromosome 15 at 69,049,413 bp
  • C to A, chromosome 15 at 73,586,936 bp
  • A to G, chromosome 17 at 25,846,312 bp
  • A to G, chromosome 17 at 43,037,818 bp
  • A to G, chromosome 17 at 46,499,012 bp
  • T to A, chromosome 18 at 37,436,015 bp
  • A to T, chromosome 19 at 6,912,771 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7288 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045395-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.