Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7297Btlr/Mmmh
Stock Number:
045401-MU
Citation ID:
RRID:MMRRC_045401-MU
Other Names:
R7297 (G1)
Major Collection:

Strain Information

Pkib
Name: protein kinase inhibitor beta, cAMP dependent, testis specific
Synonyms: PKIbeta, Prkacn2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18768
HGNC: HGNC:9018
Homologene: 7474
Ascl1
Name: achaete-scute family bHLH transcription factor 1
Synonyms: ASH1, Mash1, bHLHa46
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17172
HGNC: HGNC:738
Homologene: 31234
Msi2
Name: musashi RNA-binding protein 2
Synonyms: msi2h, Musashi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76626
Homologene: 62199
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Heatr1
Name: HEAT repeat containing 1
Synonyms: B130016L12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217995
VEGA: 13
Homologene: 34562
Asxl1
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228790
Homologene: 9098
Exosc5
Name: exosome component 5
Synonyms: D7Wsu180e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27998
Homologene: 5981
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Parp4
Name: poly (ADP-ribose) polymerase family, member 4
Synonyms: VPARP, VAULT3, p193, PH5P, E230037B21Rik, Adprtl1, C030027K23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328417
HGNC: HGNC:271
Homologene: 124423
Wbp1l
Name: WW domain binding protein 1 like
Synonyms: D19Wsu162e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226178
Homologene: 9839
Tsn
Name: translin
Synonyms: TB-RBP, 2610034C24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22099
Homologene: 3397
Stt3b
Name: STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Synonyms: Simp, 1300006C19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68292
VEGA: 9
Homologene: 7387
Cntnap1
Name: contactin associated protein-like 1
Synonyms: p190, Caspr, Nrxn4, NCP1, paranodin, shm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53321
HGNC: HGNC:8011
Homologene: 2693
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Trim2
Name: tripartite motif-containing 2
Synonyms: neural activity-related ring finger protein, narf
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80890
Homologene: 22882
Exosc10
Name: exosome component 10
Synonyms: PM/Scl-100, PM-Scl, RRP6, p4, p3, p2, Pmscl2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50912
HGNC: HGNC:9138
Homologene: 31105
Slc44a4
Name: solute carrier family 44, member 4
Synonyms: NG22, 2210409B01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70129
Homologene: 11359
Sost
Name: sclerostin
Synonyms: 5430411E23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74499
Homologene: 11542
Susd2
Name: sushi domain containing 2
Synonyms: 1200011D11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71733
VEGA: 10
Homologene: 10481
Dlx3
Name: distal-less homeobox 3
Synonyms: Dlx-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13393
HGNC: HGNC:2916
Homologene: 74544
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Arap3
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Synonyms: DRAG1, E030006K04Rik, Centd3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106952
VEGA: 18
Homologene: 11199
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Tgfbi
Name: transforming growth factor, beta induced
Synonyms: bIG-h3, 68kDa, Beta-ig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21810
VEGA: 13
Homologene: 37294
Pus7
Name: pseudouridylate synthase 7
Synonyms: C330017I15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78697
Homologene: 6998
Slc27a2
Name: solute carrier family 27 (fatty acid transporter), member 2
Synonyms: FATP2, VLCS, FATP2, Vlacs, Vlac, ACSVL1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26458
Homologene: 37830
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Nlrp9b
Name: NLR family, pyrin domain containing 9B
Synonyms: Nalp9b, Nalp-delta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243874
Homologene: 18530
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234353
Homologene: 87257
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Vmn2r84
Name: vomeronasal 2, receptor 84
Synonyms: EG625068
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625068
Homologene: 129606
Snx15
Name: sorting nexin 15
Synonyms: E130013C21Rik, 1500032B08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69024
Homologene: 12294
Micall1
Name: microtubule associated monooxygenase, calponin and LIM domain containing -like 1
Synonyms: Mus EST 820961, D15N2e, D15Mit260
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 27008
VEGA: 15
Homologene: 24911
Arhgef4
Name: Rho guanine nucleotide exchange factor 4
Synonyms: 9330140K16Rik, Asef, C230030N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Dpp10
Name: dipeptidylpeptidase 10
Synonyms: 6430601K09Rik, DPRP3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269109
Homologene: 41400
Tmem132c
Name: transmembrane protein 132C
Synonyms: 4632425D07Rik, 2810482M11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208213
Homologene: 76567
Ppm1d
Name: protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms: Wip1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53892
HGNC: HGNC:9277
Homologene: 31185
Hsd17b3
Name: hydroxysteroid (17-beta) dehydrogenase 3
Synonyms: 17(beta)HSD type 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15487
VEGA: 13
HGNC: HGNC:5212
Homologene: 20089
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Abca2
Name: ATP-binding cassette, sub-family A member 2
Synonyms: Abc2, D2H0S1474E
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11305
HGNC: HGNC:32
Homologene: 55590
Atp11a
Name: ATPase, class VI, type 11A
Synonyms: Ih, 4930558F19Rik, 9130422H11Rik, LOC100045280
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50770
Homologene: 75050
Krt87
Name: keratin 87
Synonyms: Krt2-25, Krt83
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406219
VEGA: 15
Homologene: 133804
Chrm3
Name: cholinergic receptor, muscarinic 3, cardiac
Synonyms: M3R, Chrm-3, muscarinic acetylcholine receptor 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12671
HGNC: HGNC:1952
Homologene: 20191
Simc1
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319719
Homologene: 131217
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Nrg3
Name: neuregulin 3
Synonyms: ska
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18183
HGNC: HGNC:7999
Homologene: 32051
Rbbp9
Name: retinoblastoma binding protein 9, serine hydrolase
Synonyms: Bog
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26450
HGNC: HGNC:9892
Homologene: 4816
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319901
Homologene: 12964
Asb15
Name: ankyrin repeat and SOCS box-containing 15
Synonyms: 4930400E23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78910
Homologene: 43797
Efcab12
Name: EF-hand calcium binding domain 12
Synonyms: BC060267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 212516
Homologene: 18905
Adh4
Name: alcohol dehydrogenase 4 (class II), pi polypeptide
Synonyms: mouse class II type ADH, Adh2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26876
HGNC: HGNC:252
Homologene: 20162
Vmn1r5
Name: vomeronasal 1 receptor 5
Synonyms: V1rc19
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171192
Homologene: 128340
Calu
Name: calumenin
Synonyms: 9530075H20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12321
HGNC: HGNC:1458
Homologene: 936
D6Ertd527e
Name: DNA segment, Chr 6, ERATO Doi 527, expressed
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52372
Arhgap22
Name: Rho GTPase activating protein 22
Synonyms: RHOGAP2, B230341L19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239027
Homologene: 23292
Vmn2r124
Name: vomeronasal 2, receptor 124
Synonyms: Gm7196, Vmn2r-ps113
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 637021
Homologene: 115024
Hspa14
Name: heat shock protein 14
Synonyms: NST-1, 70kDa, HSP70L1, Hsp70-4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50497
Homologene: 74307
Nfkbib
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta
Synonyms: IKappaBbeta, IkB
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18036
HGNC: HGNC:7798
Homologene: 37631
Or8d1
Name: olfactory receptor family 8 subfamily D member 1
Synonyms: MTPCR09, MOR171-9, GA_x6K02T2PVTD-32550930-32551856, Olfr26
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18324
VEGA: 9
HGNC: HGNC:8481
Homologene: 79676
Mas1
Name: MAS1 oncogene
Synonyms: Mas-1, Mas receptor, MasR
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17171
HGNC: HGNC:6899
Homologene: 1782
Plat
Name: plasminogen activator, tissue
Synonyms: t-PA, tPA, D8Ertd2e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18791
HGNC: HGNC:9051
Homologene: 717
Nutm1
Name: NUT midline carcinoma, family member 1
Synonyms: Nut, BC125332
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 213765
Homologene: 18185
Cwc15
Name: CWC15 spliceosome-associated protein
Synonyms: 2900052N06Rik, 0610040D20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66070
Homologene: 9499
Psg29
Name: pregnancy-specific beta-1-glycoprotein 29
Synonyms: cea17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 114872
Homologene: 83380
Gtf2e1
Name: general transcription factor II E, polypeptide 1 (alpha subunit)
Synonyms: TFIIE-A, FE, 2610024P03Rik, 56kDa
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74197
HGNC: HGNC:4650
Homologene: 38062
Tex46
Name: testis expressed 46
Synonyms: 4930549C01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67663
Homologene: 136495
Gm5145
Name: predicted pseudogene 5145
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381065
VEGA: 17
Slfn14
Name: schlafen 14
Synonyms: LOC237890, Slfn14-ps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237890
Homologene: 19082
Faiml
Name: Fas apoptotic inhibitory molecule like
Synonyms: Gm6432
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 623459
Utp3
Name: UTP3 small subunit processome component
Synonyms: 2400011K09Rik, Crlz1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 65961
Homologene: 10681
Gm13723
Name: predicted gene 13723
Type: Gene
Species: Mouse
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 34,807,192 bp
  • A to G, chromosome 1 at 104,970,873 bp
  • T to A, chromosome 1 at 111,861,776 bp
  • A to T, chromosome 1 at 118,300,861 bp
  • G to A, chromosome 1 at 123,353,428 bp
  • A to C, chromosome 2 at 3,498,142 bp
  • A to G, chromosome 2 at 25,442,076 bp
  • A to T, chromosome 2 at 86,873,636 bp
  • G to A, chromosome 2 at 112,250,056 bp
  • T to A, chromosome 2 at 126,578,946 bp
  • A to T, chromosome 2 at 144,543,802 bp
  • T to C, chromosome 2 at 153,397,435 bp
  • A to T, chromosome 3 at 84,210,233 bp
  • A to G, chromosome 3 at 138,429,140 bp
  • A to C, chromosome 4 at 88,820,425 bp
  • G to A, chromosome 4 at 113,542,934 bp
  • T to G, chromosome 4 at 136,612,901 bp
  • T to A, chromosome 4 at 136,945,913 bp
  • A to G, chromosome 4 at 148,580,377 bp
  • A to T, chromosome 5 at 23,741,910 bp
  • A to T, chromosome 5 at 63,936,075 bp
  • G to C, chromosome 5 at 88,554,517 bp
  • G to A, chromosome 5 at 127,360,217 bp
  • A to G, chromosome 6 at 24,566,463 bp
  • C to T, chromosome 6 at 29,356,555 bp
  • A to T, chromosome 6 at 56,986,219 bp
  • C to G, chromosome 6 at 87,111,524 bp
  • T to C, chromosome 6 at 110,646,013 bp
  • T to C, chromosome 6 at 115,811,036 bp
  • T to A, chromosome 7 at 17,210,691 bp
  • A to G, chromosome 7 at 20,049,513 bp
  • T to C, chromosome 7 at 25,666,326 bp
  • T to C, chromosome 7 at 28,766,343 bp
  • T to A, chromosome 7 at 56,136,658 bp
  • T to C, chromosome 8 at 12,806,774 bp
  • C to T, chromosome 8 at 22,775,697 bp
  • T to C, chromosome 8 at 68,121,034 bp
  • G to A, chromosome 9 at 14,510,229 bp
  • G to A, chromosome 9 at 38,855,949 bp
  • T to C, chromosome 9 at 99,229,613 bp
  • A to G, chromosome 9 at 115,276,957 bp
  • A to T, chromosome 10 at 57,736,326 bp
  • T to C, chromosome 10 at 75,642,568 bp
  • A to T, chromosome 10 at 87,492,464 bp
  • T to C, chromosome 10 at 130,391,250 bp
  • T to A, chromosome 11 at 83,278,995 bp
  • A to T, chromosome 11 at 85,345,995 bp
  • A to T, chromosome 11 at 88,480,038 bp
  • C to A, chromosome 11 at 95,120,450 bp
  • A to G, chromosome 11 at 101,188,634 bp
  • C to T, chromosome 11 at 101,964,103 bp
  • C to T, chromosome 11 at 110,183,026 bp
  • A to T, chromosome 11 at 118,055,730 bp
  • A to G, chromosome 11 at 118,103,356 bp
  • T to G, chromosome 12 at 52,887,364 bp
  • T to A, chromosome 13 at 9,877,833 bp
  • C to T, chromosome 13 at 12,421,060 bp
  • AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG to AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG, chromosome 13 at 54,525,235 bp
  • T to A, chromosome 13 at 56,632,113 bp
  • T to C, chromosome 13 at 64,076,351 bp
  • C to T, chromosome 14 at 33,271,933 bp
  • T to C, chromosome 14 at 38,370,939 bp
  • C to T, chromosome 14 at 56,647,681 bp
  • C to T, chromosome 15 at 73,557,610 bp
  • T to C, chromosome 15 at 79,120,897 bp
  • T to C, chromosome 15 at 101,489,647 bp
  • T to C, chromosome 16 at 37,536,065 bp
  • T to C, chromosome 17 at 12,841,858 bp
  • A to T, chromosome 17 at 18,073,573 bp
  • G to A, chromosome 17 at 20,570,731 bp
  • G to A, chromosome 17 at 31,008,665 bp
  • T to A, chromosome 17 at 34,927,912 bp
  • G to A, chromosome 18 at 37,973,563 bp
  • T to A, chromosome 19 at 6,120,507 bp
  • A to G, chromosome 19 at 46,654,400 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7297 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045401-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.