Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7297Btlr/Mmmh
Stock Number:
045401-MU
Citation ID:
RRID:MMRRC_045401-MU
Other Names:
R7297 (G1)
Major Collection:

Strain Information

Pkib
Name: protein kinase inhibitor beta, cAMP dependent, testis specific
Synonyms: PKIbeta, Prkacn2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18768
HGNC: HGNC:9018
Homologene: 7474
Ascl1
Name: achaete-scute family bHLH transcription factor 1
Synonyms: ASH1, Mash1, bHLHa46
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17172
HGNC: HGNC:738
Homologene: 31234
Msi2
Name: musashi RNA-binding protein 2
Synonyms: msi2h, Musashi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76626
Homologene: 62199
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Heatr1
Name: HEAT repeat containing 1
Synonyms: B130016L12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217995
VEGA: 13
Homologene: 34562
Asxl1
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228790
Homologene: 9098
Exosc5
Name: exosome component 5
Synonyms: D7Wsu180e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27998
Homologene: 5981
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 34,807,192 bp
  • A to G, chromosome 1 at 104,970,873 bp
  • T to A, chromosome 1 at 111,861,776 bp
  • A to T, chromosome 1 at 118,300,861 bp
  • G to A, chromosome 1 at 123,353,428 bp
  • A to C, chromosome 2 at 3,498,142 bp
  • A to G, chromosome 2 at 25,442,076 bp
  • A to T, chromosome 2 at 86,873,636 bp
  • G to A, chromosome 2 at 112,250,056 bp
  • T to A, chromosome 2 at 126,578,946 bp
  • A to T, chromosome 2 at 144,543,802 bp
  • T to C, chromosome 2 at 153,397,435 bp
  • A to T, chromosome 3 at 84,210,233 bp
  • A to G, chromosome 3 at 138,429,140 bp
  • A to C, chromosome 4 at 88,820,425 bp
  • G to A, chromosome 4 at 113,542,934 bp
  • T to G, chromosome 4 at 136,612,901 bp
  • T to A, chromosome 4 at 136,945,913 bp
  • A to G, chromosome 4 at 148,580,377 bp
  • A to T, chromosome 5 at 23,741,910 bp
  • A to T, chromosome 5 at 63,936,075 bp
  • G to C, chromosome 5 at 88,554,517 bp
  • G to A, chromosome 5 at 127,360,217 bp
  • A to G, chromosome 6 at 24,566,463 bp
  • C to T, chromosome 6 at 29,356,555 bp
  • A to T, chromosome 6 at 56,986,219 bp
  • C to G, chromosome 6 at 87,111,524 bp
  • T to C, chromosome 6 at 110,646,013 bp
  • T to C, chromosome 6 at 115,811,036 bp
  • T to A, chromosome 7 at 17,210,691 bp
  • A to G, chromosome 7 at 20,049,513 bp
  • T to C, chromosome 7 at 25,666,326 bp
  • T to C, chromosome 7 at 28,766,343 bp
  • T to A, chromosome 7 at 56,136,658 bp
  • T to C, chromosome 8 at 12,806,774 bp
  • C to T, chromosome 8 at 22,775,697 bp
  • T to C, chromosome 8 at 68,121,034 bp
  • G to A, chromosome 9 at 14,510,229 bp
  • G to A, chromosome 9 at 38,855,949 bp
  • T to C, chromosome 9 at 99,229,613 bp
  • A to G, chromosome 9 at 115,276,957 bp
  • A to T, chromosome 10 at 57,736,326 bp
  • T to C, chromosome 10 at 75,642,568 bp
  • A to T, chromosome 10 at 87,492,464 bp
  • T to C, chromosome 10 at 130,391,250 bp
  • T to A, chromosome 11 at 83,278,995 bp
  • A to T, chromosome 11 at 85,345,995 bp
  • A to T, chromosome 11 at 88,480,038 bp
  • C to A, chromosome 11 at 95,120,450 bp
  • A to G, chromosome 11 at 101,188,634 bp
  • C to T, chromosome 11 at 101,964,103 bp
  • C to T, chromosome 11 at 110,183,026 bp
  • A to T, chromosome 11 at 118,055,730 bp
  • A to G, chromosome 11 at 118,103,356 bp
  • T to G, chromosome 12 at 52,887,364 bp
  • T to A, chromosome 13 at 9,877,833 bp
  • C to T, chromosome 13 at 12,421,060 bp
  • AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG to AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG, chromosome 13 at 54,525,235 bp
  • T to A, chromosome 13 at 56,632,113 bp
  • T to C, chromosome 13 at 64,076,351 bp
  • C to T, chromosome 14 at 33,271,933 bp
  • T to C, chromosome 14 at 38,370,939 bp
  • C to T, chromosome 14 at 56,647,681 bp
  • C to T, chromosome 15 at 73,557,610 bp
  • T to C, chromosome 15 at 79,120,897 bp
  • T to C, chromosome 15 at 101,489,647 bp
  • T to C, chromosome 16 at 37,536,065 bp
  • T to C, chromosome 17 at 12,841,858 bp
  • A to T, chromosome 17 at 18,073,573 bp
  • G to A, chromosome 17 at 20,570,731 bp
  • G to A, chromosome 17 at 31,008,665 bp
  • T to A, chromosome 17 at 34,927,912 bp
  • G to A, chromosome 18 at 37,973,563 bp
  • T to A, chromosome 19 at 6,120,507 bp
  • A to G, chromosome 19 at 46,654,400 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7297 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045401-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.