Strain Name:
C57BL/6J-MtgxR7324Btlr/Mmmh
Stock Number:
045418-MU
Citation ID:
RRID:MMRRC_045418-MU
Other Names:
R7324 (G1)
Major Collection:

Strain Information

Inpp5a
Name: inositol polyphosphate-5-phosphatase A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212111
HGNC: HGNC:6076
Homologene: 4045
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, Macf2, bullous pemphigoid antigen 1, athetoid, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Hsp90aa1
Name: heat shock protein 90, alpha (cytosolic), class A member 1
Synonyms: hsp4, Hsp90, Hsp86-1, Hsp89, Hspca
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15519
HGNC: HGNC:5253
Homologene: 68464
Ephx2
Name: epoxide hydrolase 2, cytoplasmic
Synonyms: Eph2, sEP, sEH
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13850
VEGA: 14
HGNC: HGNC:3402
Homologene: 37558
Llgl2
Name: LLGL2 scribble cell polarity complex component
Synonyms: 9130006H11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217325
HGNC: HGNC:6629
Homologene: 3323
Enpp2
Name: ectonucleotide pyrophosphatase/phosphodiesterase 2
Synonyms: Autotaxin, Npps2, PD-Ialpha, Pdnp2, ATX
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18606
HGNC: HGNC:3357
Homologene: 4526
Prtg
Name: protogenin
Synonyms: A230098A12Rik, Igdcc5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235472
Homologene: 54453
Larp4b
Name: La ribonucleoprotein 4B
Synonyms: D13Wsu64e, Larp5, A130023E24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217980
Homologene: 18195
Fancl
Name: Fanconi anemia, complementation group L
Synonyms: 2010322C19Rik, gcd, Pog, Phf9, B230118H11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67030
Homologene: 9987
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Opa1
Name: OPA1, mitochondrial dynamin like GTPase
Synonyms: 1200011N24Rik, lilr3, optic atrophy 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74143
HGNC: HGNC:8140
Homologene: 14618
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329877
Homologene: 23057
Abcg5
Name: ATP binding cassette subfamily G member 5
Synonyms: Sterolin-1, trac, cmp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27409
Homologene: 31909
Kctd17
Name: potassium channel tetramerisation domain containing 17
Synonyms: 2900008M13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72844
Homologene: 23468
Csnk1g3
Name: casein kinase 1, gamma 3
Synonyms: 3300002K07Rik, C330049O21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70425
VEGA: 18
HGNC: HGNC:2456
Homologene: 121650
Osbpl2
Name: oxysterol binding protein-like 2
Synonyms: ORP-2, C130070J12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228983
Homologene: 77324
Slc39a2
Name: solute carrier family 39 (zinc transporter), member 2
Synonyms: zip2, F730005G13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 214922
Homologene: 40957
Ackr3
Name: atypical chemokine receptor 3
Synonyms: Rdc1, Cmkor1, Cxcr7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12778
Homologene: 22419
Kcnn2
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Synonyms: small conductance calcium-activated potassium channel 2, SK2, fri, bc
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 140492
HGNC: HGNC:6291
Homologene: 135651
Flii
Name: flightless I actin binding protein
Synonyms: 3632430F08Rik, Fliih
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14248
HGNC: HGNC:3750
Homologene: 11092
Casz1
Name: castor zinc finger 1
Synonyms: 2410019P08Rik, D4Ertd432e, castor, Cst
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69743
Homologene: 9824
C1qtnf3
Name: C1q and tumor necrosis factor related protein 3
Synonyms: CORS-26, Corcs, 2310005P21Rik, CTRP3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 81799
Homologene: 12788
Nktr
Name: natural killer tumor recognition sequence
Synonyms: D9Wsu172e, 5330401F18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18087
HGNC: HGNC:7833
Homologene: 122148
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Ddx24
Name: DEAD box helicase 24
Synonyms: 2510027P10Rik, 1700055J08Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27225
VEGA: 12
Homologene: 10702
Ilkap
Name: integrin-linked kinase-associated serine/threonine phosphatase 2C
Synonyms: 1600009O09Rik, PP2C-DELTA, 0710007A14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67444
Homologene: 31525
Wtap
Name: WT1 associating protein
Synonyms: 9430038B09Rik, 2810408K05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 60532
Homologene: 68422
Arhgap28
Name: Rho GTPase activating protein 28
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268970
Homologene: 18264
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Rundc3a
Name: RUN domain containing 3A
Synonyms: Rpip8, Rap2ip
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 51799
Homologene: 4871
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Ankrd52
Name: ankyrin repeat domain 52
Synonyms: G431002C21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237615
Homologene: 18227
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Cdh5
Name: cadherin 5
Synonyms: VE-cadherin, 7B4/cadherin-5, VEC, CD144, VE-Cad, VECD, VEcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12562
HGNC: HGNC:1764
Homologene: 1359
Vinac1
Name: vinculin/alpha-catenin family member 1
Synonyms: Gm14025
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668894
Homologene: 86340
Clca3a2
Name: chloride channel accessory 3A2
Synonyms: Clca2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80797
HGNC: HGNC:2017
Homologene: 77224
Maz
Name: MYC-associated zinc finger protein (purine-binding transcription factor)
Synonyms: Pur-1, PUR1, SAF-2, SAF-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17188
HGNC: HGNC:6914
Homologene: 106451
Rhpn1
Name: rhophilin, Rho GTPase binding protein 1
Synonyms: Rhophilin, Grbp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14787
Homologene: 7346
Ddb2
Name: damage specific DNA binding protein 2
Synonyms: p48, 2610043A19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107986
HGNC: HGNC:2718
Homologene: 83
Itgad
Name: integrin, alpha D
Synonyms: Cd11d
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381924
HGNC: HGNC:6146
Homologene: 56919
Scara3
Name: scavenger receptor class A, member 3
Synonyms: C130058N24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219151
VEGA: 14
Homologene: 9437
Cyp2d10
Name: cytochrome P450, family 2, subfamily d, polypeptide 10
Synonyms: P450-2D, Cyp2d
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13101
VEGA: 15
Homologene: 86099
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: enteropeptidase, enterokinase, A130097D21Rik, Prss7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Nin
Name: ninein
Synonyms: 3110068G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18080
Homologene: 40632
Plekhh3
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217198
Homologene: 11787
Tufm
Name: Tu translation elongation factor, mitochondrial
Synonyms: EF-TuMT, 2300002G02Rik, C76308
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233870
Homologene: 2490
C2
Name: complement C2
Synonyms: classical-complement pathway C3/C5 convertase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12263
HGNC: HGNC:1248
Homologene: 45
Mmrn1
Name: multimerin 1
Synonyms: 4921530G03Rik, Emilin4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70945
HGNC: HGNC:7178
Homologene: 49134
Mvp
Name: major vault protein
Synonyms: VAULT1, LRP, 2310009M24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78388
HGNC: HGNC:7531
Homologene: 3752
Tssk2
Name: testis-specific serine kinase 2
Synonyms: Tsk2, SPOGA2, DGS-G, Stk22b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22115
VEGA: 16
Homologene: 31512
Efcab12
Name: EF-hand calcium binding domain 12
Synonyms: BC060267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 212516
Homologene: 18905
Fndc7
Name: fibronectin type III domain containing 7
Synonyms: E230011A21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320181
Homologene: 18551
Clca3b
Name: chloride channel accessory 3B
Synonyms: Clca4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229927
HGNC: HGNC:2017
Homologene: 135610
Or1r1
Name: olfactory receptor family 1 subfamily JRmember 1
Synonyms: GA_x6K02T2P1NL-4141430-4140486, MOR157-1, Olfr398
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258705
HGNC: HGNC:8226
Homologene: 17355
Or2n1c
Name: olfactory receptor family 2 subfamily N member 1C
Synonyms: GA_x6K02T2PSCP-2656648-2657586, MOR256-48, Olfr135
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258329
Homologene: 110603
Etnppl
Name: ethanolamine phosphate phospholyase
Synonyms: 1300019H02Rik, Agxt2l1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71760
Homologene: 69440
Or5b123
Name: olfactory receptor family 5 subfamily B member 123
Synonyms: GA_x6K02T2RE5P-3951719-3952666, MOR202-18, Olfr1487
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258629
Homologene: 110492
Nod2
Name: nucleotide-binding oligomerization domain containing 2
Synonyms: F830032C23Rik, Nlrc2, Card15
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 257632
HGNC: HGNC:5331
Homologene: 11156
H2-T10
Name: histocompatibility 2, T region locus 10
Synonyms: H-2T10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15024
Reg2
Name: regenerating islet-derived 2
Synonyms: pancreatic thread protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19693
Homologene: 68517
Slc23a2
Name: solute carrier family 23 (nucleobase transporters), member 2
Synonyms: YSPL3, SVCT2, Slc23a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54338
Homologene: 68440
H2-DMb1
Name: histocompatibility 2, class II, locus Mb1
Synonyms: H2-Mb1, H-2Mb1, H2-M beta1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14999
HGNC: HGNC:4935
Homologene: 68231
Or7e174
Name: olfactory receptor family 7 subfamily E member 174
Synonyms: GA_x6K02T2PVTD-13841888-13842802, MOR145-4, Olfr868
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258552
HGNC: HGNC:8396
Homologene: 74168
Ighe
Name: Immunoglobulin heavy constant epsilon
Synonyms: LOC380792, Gm900
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380792
HGNC: HGNC:5522
Harbi1
Name: harbinger transposase derived 1
Synonyms: D230010M03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241547
Homologene: 24535
Fam162b
Name: family with sequence similarity 162, member B
Synonyms: 9430073N08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77296
VEGA: 10
Homologene: 82459
Or5ac21
Name: olfactory receptor family 5 subfamily AC member 21
Synonyms: GA_x54KRFPKG5P-55517445-55518365, MOR182-5, Olfr203
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258479
Homologene: 122781
Or4a76
Name: olfactory receptor family 4 subfamily A member 76
Synonyms: MOR231-16P, GA_x6K02T2Q125-51072323-51071367, MOR231-16P, MOR231-25_p, MOR231-17P, Olfr1541-ps1, Olfr1249
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257984
Or6c88
Name: olfactory receptor family 6 subfamily C member 88
Synonyms: GA_x6K02T2PULF-11248702-11249664, MOR114-11, Olfr794
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258375
Homologene: 45066
Pcp4l1
Name: Purkinje cell protein 4-like 1
Synonyms: 1500036F01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66425
Homologene: 136091
Ighv7-1
Name: immunoglobulin heavy variable 7-1
Synonyms: Gm16698
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 780799
Or10w3
Name: olfactory receptor family 10 subfamily W member 3
Synonyms: GA_x6K02T2RE5P-4059239-4060188, MOR266-3, Olfr1493
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258735
Cc2d2b
Name: coiled-coil and C2 domain containing 2B
Synonyms: EG668310
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668310
Homologene: 141114
AL732309.1
Name:
Type: Gene
Species: Mouse
Chromosome: 2
Gm26661
Name: predicted gene, 26661
Type: Gene
Species: Mouse
Chromosome: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,006,224 bp
  • T to C, chromosome 1 at 43,978,778 bp
  • C to G, chromosome 1 at 90,214,201 bp
  • A to T, chromosome 1 at 91,385,393 bp
  • TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA to TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA, chromosome 1 at 164,193,581 bp
  • G to A, chromosome 1 at 171,174,465 bp
  • T to G, chromosome 1 at 189,863,424 bp
  • A to C, chromosome 2 at 25,246,139 bp
  • T to A, chromosome 2 at 76,895,593 bp
  • A to T, chromosome 2 at 89,630,103 bp
  • G to A, chromosome 2 at 91,236,884 bp
  • T to C, chromosome 2 at 91,720,699 bp
  • T to C, chromosome 2 at 129,037,852 bp
  • G to A, chromosome 2 at 132,089,123 bp
  • A to G, chromosome 2 at 180,150,201 bp
  • G to T, chromosome 3 at 108,872,221 bp
  • A to G, chromosome 3 at 130,629,575 bp
  • G to A, chromosome 3 at 144,808,611 bp
  • T to A, chromosome 3 at 144,841,420 bp
  • T to C, chromosome 4 at 86,829,738 bp
  • T to C, chromosome 4 at 123,374,425 bp
  • C to T, chromosome 4 at 148,947,033 bp
  • G to T, chromosome 6 at 60,944,933 bp
  • A to T, chromosome 6 at 78,406,154 bp
  • T to C, chromosome 6 at 115,823,594 bp
  • G to A, chromosome 7 at 126,489,587 bp
  • A to G, chromosome 7 at 126,993,609 bp
  • G to A, chromosome 7 at 127,024,593 bp
  • A to T, chromosome 7 at 128,189,807 bp
  • A to G, chromosome 7 at 139,525,670 bp
  • G to A, chromosome 8 at 16,058,707 bp
  • T to A, chromosome 8 at 88,653,066 bp
  • A to G, chromosome 8 at 104,142,793 bp
  • A to T, chromosome 9 at 20,101,430 bp
  • C to T, chromosome 9 at 72,890,840 bp
  • C to T, chromosome 9 at 121,727,361 bp
  • T to A, chromosome 9 at 121,748,291 bp
  • A to T, chromosome 10 at 51,590,186 bp
  • A to T, chromosome 10 at 68,128,922 bp
  • C to A, chromosome 10 at 128,386,163 bp
  • T to A, chromosome 10 at 129,570,849 bp
  • A to G, chromosome 11 at 26,403,362 bp
  • G to A, chromosome 11 at 60,719,040 bp
  • A to G, chromosome 11 at 73,983,843 bp
  • T to A, chromosome 11 at 101,170,774 bp
  • A to G, chromosome 11 at 102,399,973 bp
  • A to G, chromosome 11 at 115,850,730 bp
  • C to T, chromosome 12 at 70,043,734 bp
  • C to A, chromosome 12 at 103,416,259 bp
  • A to G, chromosome 12 at 110,695,225 bp
  • T to A, chromosome 12 at 113,272,334 bp
  • T to C, chromosome 12 at 113,896,529 bp
  • C to A, chromosome 13 at 9,158,580 bp
  • T to C, chromosome 14 at 7,791,911 bp
  • A to G, chromosome 14 at 33,047,314 bp
  • T to G, chromosome 14 at 51,894,193 bp
  • T to A, chromosome 14 at 65,931,416 bp
  • A to G, chromosome 14 at 66,085,354 bp
  • A to C, chromosome 15 at 10,952,621 bp
  • A to G, chromosome 15 at 54,877,774 bp
  • A to T, chromosome 15 at 75,704,397 bp
  • T to A, chromosome 15 at 78,435,642 bp
  • T to G, chromosome 15 at 82,403,760 bp
  • T to C, chromosome 16 at 17,899,363 bp
  • A to T, chromosome 16 at 29,586,981 bp
  • T to C, chromosome 16 at 59,303,248 bp
  • T to C, chromosome 16 at 78,962,019 bp
  • T to C, chromosome 17 at 12,980,946 bp
  • T to A, chromosome 17 at 30,784,125 bp
  • T to C, chromosome 17 at 34,159,462 bp
  • C to T, chromosome 17 at 34,881,688 bp
  • C to T, chromosome 17 at 36,119,297 bp
  • T to C, chromosome 17 at 38,208,716 bp
  • T to C, chromosome 17 at 67,895,884 bp
  • T to C, chromosome 17 at 84,676,239 bp
  • A to T, chromosome 18 at 45,560,071 bp
  • A to G, chromosome 18 at 53,919,018 bp
  • A to G, chromosome 19 at 13,619,578 bp
  • C to T, chromosome 19 at 13,726,906 bp
  • A to G, chromosome 19 at 40,809,108 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7324 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045418-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.