Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7324Btlr/Mmmh
Stock Number:
045418-MU
Citation ID:
RRID:MMRRC_045418-MU
Other Names:
R7324 (G1)
Major Collection:

Strain Information

Inpp5a
Name: inositol polyphosphate-5-phosphatase A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212111
HGNC: HGNC:6076
Homologene: 4045
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Hsp90aa1
Name: heat shock protein 90, alpha (cytosolic), class A member 1
Synonyms: hsp4, Hsp90, Hsp86-1, Hsp89, Hspca
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15519
Homologene: 68464
Ephx2
Name: epoxide hydrolase 2, cytoplasmic
Synonyms: Eph2, sEP, sEH
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13850
VEGA: 14
HGNC: HGNC:3402
Homologene: 37558
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,006,224 bp
  • T to C, chromosome 1 at 43,978,778 bp
  • C to G, chromosome 1 at 90,214,201 bp
  • A to T, chromosome 1 at 91,385,393 bp
  • TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA to TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA, chromosome 1 at 164,193,581 bp
  • G to A, chromosome 1 at 171,174,465 bp
  • T to G, chromosome 1 at 189,863,424 bp
  • A to C, chromosome 2 at 25,246,139 bp
  • T to A, chromosome 2 at 76,895,593 bp
  • A to T, chromosome 2 at 89,630,103 bp
  • G to A, chromosome 2 at 91,236,884 bp
  • T to C, chromosome 2 at 91,720,699 bp
  • T to C, chromosome 2 at 129,037,852 bp
  • G to A, chromosome 2 at 132,089,123 bp
  • A to G, chromosome 2 at 180,150,201 bp
  • G to T, chromosome 3 at 108,872,221 bp
  • A to G, chromosome 3 at 130,629,575 bp
  • G to A, chromosome 3 at 144,808,611 bp
  • T to A, chromosome 3 at 144,841,420 bp
  • T to C, chromosome 4 at 86,829,738 bp
  • T to C, chromosome 4 at 123,374,425 bp
  • C to T, chromosome 4 at 148,947,033 bp
  • G to T, chromosome 6 at 60,944,933 bp
  • A to T, chromosome 6 at 78,406,154 bp
  • T to C, chromosome 6 at 115,823,594 bp
  • G to A, chromosome 7 at 126,489,587 bp
  • A to G, chromosome 7 at 126,993,609 bp
  • G to A, chromosome 7 at 127,024,593 bp
  • A to T, chromosome 7 at 128,189,807 bp
  • A to G, chromosome 7 at 139,525,670 bp
  • G to A, chromosome 8 at 16,058,707 bp
  • T to A, chromosome 8 at 88,653,066 bp
  • A to G, chromosome 8 at 104,142,793 bp
  • A to T, chromosome 9 at 20,101,430 bp
  • C to T, chromosome 9 at 72,890,840 bp
  • C to T, chromosome 9 at 121,727,361 bp
  • T to A, chromosome 9 at 121,748,291 bp
  • A to T, chromosome 10 at 51,590,186 bp
  • A to T, chromosome 10 at 68,128,922 bp
  • C to A, chromosome 10 at 128,386,163 bp
  • T to A, chromosome 10 at 129,570,849 bp
  • A to G, chromosome 11 at 26,403,362 bp
  • G to A, chromosome 11 at 60,719,040 bp
  • A to G, chromosome 11 at 73,983,843 bp
  • T to A, chromosome 11 at 101,170,774 bp
  • A to G, chromosome 11 at 102,399,973 bp
  • A to G, chromosome 11 at 115,850,730 bp
  • C to T, chromosome 12 at 70,043,734 bp
  • C to A, chromosome 12 at 103,416,259 bp
  • A to G, chromosome 12 at 110,695,225 bp
  • T to A, chromosome 12 at 113,272,334 bp
  • T to C, chromosome 12 at 113,896,529 bp
  • C to A, chromosome 13 at 9,158,580 bp
  • T to C, chromosome 14 at 7,791,911 bp
  • A to G, chromosome 14 at 33,047,314 bp
  • T to G, chromosome 14 at 51,894,193 bp
  • T to A, chromosome 14 at 65,931,416 bp
  • A to G, chromosome 14 at 66,085,354 bp
  • A to C, chromosome 15 at 10,952,621 bp
  • A to G, chromosome 15 at 54,877,774 bp
  • A to T, chromosome 15 at 75,704,397 bp
  • T to A, chromosome 15 at 78,435,642 bp
  • T to G, chromosome 15 at 82,403,760 bp
  • T to C, chromosome 16 at 17,899,363 bp
  • A to T, chromosome 16 at 29,586,981 bp
  • T to C, chromosome 16 at 59,303,248 bp
  • T to C, chromosome 16 at 78,962,019 bp
  • T to C, chromosome 17 at 12,980,946 bp
  • T to A, chromosome 17 at 30,784,125 bp
  • T to C, chromosome 17 at 34,159,462 bp
  • C to T, chromosome 17 at 34,881,688 bp
  • C to T, chromosome 17 at 36,119,297 bp
  • T to C, chromosome 17 at 38,208,716 bp
  • T to C, chromosome 17 at 67,895,884 bp
  • T to C, chromosome 17 at 84,676,239 bp
  • A to T, chromosome 18 at 45,560,071 bp
  • A to G, chromosome 18 at 53,919,018 bp
  • A to G, chromosome 19 at 13,619,578 bp
  • C to T, chromosome 19 at 13,726,906 bp
  • A to G, chromosome 19 at 40,809,108 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7324 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045418-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.