Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7374Btlr/Mmmh
Stock Number:
045457-MU
Citation ID:
RRID:MMRRC_045457-MU
Other Names:
R7374 (G1)
Major Collection:

Strain Information

Hfe
Name: homeostatic iron regulator
Synonyms: MR2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15216
HGNC: HGNC:4886
Homologene: 88330
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Mtbp
Name: Mdm2, transformed 3T3 cell double minute p53 binding protein
Synonyms: MDM2BP
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105837
HGNC: HGNC:7417
Homologene: 11102
Rfx5
Name: regulatory factor X, 5 (influences HLA class II expression)
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53970
HGNC: HGNC:9986
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 2 at 86,413,852 bp
  • T to C, chromosome 2 at 129,284,963 bp
  • T to C, chromosome 3 at 80,741,076 bp
  • C to T, chromosome 3 at 94,958,742 bp
  • A to T, chromosome 3 at 96,188,209 bp
  • T to A, chromosome 3 at 103,310,323 bp
  • A to G, chromosome 4 at 118,257,492 bp
  • G to C, chromosome 4 at 123,817,865 bp
  • T to A, chromosome 4 at 148,156,637 bp
  • C to A, chromosome 5 at 110,657,132 bp
  • A to G, chromosome 5 at 122,101,663 bp
  • C to T, chromosome 5 at 137,735,529 bp
  • G to A, chromosome 5 at 142,485,480 bp
  • G to A, chromosome 6 at 40,757,439 bp
  • A to G, chromosome 6 at 87,050,977 bp
  • A to T, chromosome 6 at 90,179,136 bp
  • T to C, chromosome 6 at 90,338,833 bp
  • T to C, chromosome 7 at 5,454,161 bp
  • T to C, chromosome 7 at 30,820,040 bp
  • A to T, chromosome 7 at 85,232,399 bp
  • T to C, chromosome 7 at 85,957,422 bp
  • T to C, chromosome 7 at 102,009,128 bp
  • A to G, chromosome 7 at 108,346,888 bp
  • A to T, chromosome 7 at 141,863,126 bp
  • A to T, chromosome 8 at 13,474,802 bp
  • A to C, chromosome 8 at 33,268,911 bp
  • A to G, chromosome 9 at 95,055,489 bp
  • G to A, chromosome 10 at 60,317,900 bp
  • A to G, chromosome 10 at 93,682,572 bp
  • C to T, chromosome 11 at 9,292,136 bp
  • A to T, chromosome 11 at 14,599,962 bp
  • T to A, chromosome 11 at 57,189,808 bp
  • T to C, chromosome 12 at 34,985,425 bp
  • A to T, chromosome 12 at 84,606,243 bp
  • C to T, chromosome 12 at 84,830,175 bp
  • T to G, chromosome 13 at 23,706,047 bp
  • A to T, chromosome 13 at 95,989,136 bp
  • A to G, chromosome 14 at 44,403,783 bp
  • T to C, chromosome 14 at 44,650,283 bp
  • A to G, chromosome 14 at 52,983,843 bp
  • T to A, chromosome 15 at 8,247,247 bp
  • A to C, chromosome 15 at 55,562,959 bp
  • G to A, chromosome 15 at 82,095,908 bp
  • G to T, chromosome 16 at 36,751,845 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • T to A, chromosome 17 at 6,304,258 bp
  • A to G, chromosome 17 at 90,588,669 bp
  • G to A, chromosome 18 at 61,071,708 bp
  • T to C, chromosome 19 at 39,739,204 bp
  • T to C, chromosome Y at 941,491 bp
  • T to C, chromosome Y at 1,381,305 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7374 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045457-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.