Strain Name:
C57BL/6J-MtgxR7412Btlr/Mmmh
Stock Number:
045493-MU
Citation ID:
RRID:MMRRC_045493-MU
Other Names:
R7412 (G1)
Major Collection:

Strain Information

Ndrg1
Name: N-myc downstream regulated gene 1
Synonyms: Ndrl, Tdd5, DRG1, TDD5, CMT4D, Ndr1, PROXY1, CAP43
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17988
HGNC: HGNC:7679
Homologene: 55953
Xpnpep1
Name: X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms: D230045I08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170750
Homologene: 6424
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: Carmil, Lrrc16, Lrrc16a, 1110037D04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Nf1
Name: neurofibromin 1
Synonyms: Dsk9, neurofibromin, Nf-1, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Ddx56
Name: DEAD box helicase 56
Synonyms: 2600001H07Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 56, D11Ertd619e, NOH61
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52513
Homologene: 6498
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Plk4
Name: polo like kinase 4
Synonyms: Sak, Stk18
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20873
Homologene: 7962
Ap2a2
Name: adaptor-related protein complex 2, alpha 2 subunit
Synonyms: alpha-adaptin C, Adtab, alpha-C adaptin, L25, 2410074K14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11772
HGNC: HGNC:562
Homologene: 5335
Xrn2
Name: 5'-3' exoribonuclease 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24128
Homologene: 6927
Tex9
Name: testis expressed gene 9
Synonyms: tsec-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21778
Homologene: 32072
Zgrf1
Name: zinc finger, GRF-type containing 1
Synonyms: 4930422G04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71643
Homologene: 34708
Nasp
Name: nuclear autoantigenic sperm protein (histone-binding)
Synonyms: Epcs32, 5033430J04Rik, Nasp-T, D4Ertd767e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50927
HGNC: HGNC:7644
Homologene: 133894
Cnot10
Name: CCR4-NOT transcription complex, subunit 10
Synonyms: 2600001P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78893
VEGA: 9
Homologene: 41040
Slc39a1
Name: solute carrier family 39 (zinc transporter), member 1
Synonyms: zip1, Zirtl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30791
Homologene: 40906
Ipo13
Name: importin 13
Synonyms: Imp13, Kap13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230673
Homologene: 40968
Ganab
Name: alpha glucosidase 2 alpha neutral subunit
Synonyms: GluII, G2an
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14376
VEGA: 19
HGNC: HGNC:4138
Homologene: 5426
Arhgap33
Name: Rho GTPase activating protein 33
Synonyms: Snx26, NOMA-GAP, Tcgap
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233071
Homologene: 76448
Enpp5
Name: ectonucleotide pyrophosphatase/phosphodiesterase 5
Synonyms: D17Abb1e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 83965
Homologene: 23313
Hspa9
Name: heat shock protein 9
Synonyms: C3H-specific antigen, Hsp74a, mthsp70, Hsp74, mot-2, PBP74, Hsc74, mortalin, CSA, GRP75, Hspa9a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15526
HGNC: HGNC:5244
Homologene: 39452
Nrde2
Name: nrde-2 necessary for RNA interference, domain containing
Synonyms: BC002230, 6720454P05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217827
VEGA: 12
Homologene: 41213
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
Slc4a4
Name: solute carrier family 4 (anion exchanger), member 4
Synonyms: NBC, NBC1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54403
Homologene: 55776
Setd1b
Name: SET domain containing 1B
Synonyms: KMT2G
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208043
Homologene: 134654
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 5330435L01Rik, 4632412F08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237979
Homologene: 10406
Fbxo24
Name: F-box protein 24
Synonyms: Fbx24, 4933422D21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71176
Homologene: 14131
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Brinp3
Name: bone morphogenetic protein/retinoic acid inducible neural specific 3
Synonyms: B830045N13Rik, Fam5c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215378
Homologene: 17786
Ephb6
Name: Eph receptor B6
Synonyms: Mep, Cekl
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13848
HGNC: HGNC:3396
Homologene: 20940
Arvcf
Name: armadillo repeat gene deleted in velocardiofacial syndrome
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11877
HGNC: HGNC:728
Homologene: 31046
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Sgcz
Name: sarcoglycan zeta
Synonyms: C230085N17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244431
Homologene: 26726
Or5au1
Name: olfactory receptor family 5 subfamily AU member 1
Synonyms: GA_x6K02T2RJGY-959918-960853, Olfr221, MOR205-2, Olfr1514, GA_x6K02SYYB8M-929-258, MOR205-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258420
Homologene: 45823
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Dhx30
Name: DExH-box helicase 30
Synonyms: 2810477H02Rik, Ddx30, C130058C04Rik, helG, DEAH (Asp-Glu-Ala-His) box polypeptide 30
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72831
Homologene: 15779
1700017N19Rik
Name: RIKEN cDNA 1700017N19 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66605
Homologene: 45135
Gmip
Name: Gem-interacting protein
Synonyms: 5031419I10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78816
Homologene: 9570
Fam83a
Name: family with sequence similarity 83, member A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239463
Homologene: 13158
Or7g17
Name: olfactory receptor family 7 subfamily G member 17
Synonyms: MOR147-1, Olfr829, GA_x6K02T2PVTD-12599710-12600648
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259070
HGNC: HGNC:8466
Homologene: 138324
Cfap57
Name: cilia and flagella associated protein 57
Synonyms: 1110020C03Rik, LOC384050, Wdr65, C130004B06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68625
Homologene: 51350
Osmr
Name: oncostatin M receptor
Synonyms: OSMRB
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18414
HGNC: HGNC:8507
Homologene: 2972
Sptlc3
Name: serine palmitoyltransferase, long chain base subunit 3
Synonyms: C130053K05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228677
Homologene: 105590
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: VE-PTP, 3230402H02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Skint8
Name: selection and upkeep of intraepithelial T cells 8
Synonyms: OTTMUSG00000009475
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639774
Homologene: 106613
Or1j4
Name: olfactory receptor family 1 subfamily J member 4
Synonyms: GA_x6K02T2NLDC-33544602-33545540, MOR136-13, Olfr350
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258620
HGNC: HGNC:8211
Homologene: 64897
Irag1
Name: inositol 1,4,5-triphosphate receptor associated 1
Synonyms: Ris1, Mrvi1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17540
HGNC: HGNC:7237
Homologene: 4425
Klrb1f
Name: killer cell lectin-like receptor subfamily B member 1F
Synonyms: Nkrp1f, A630024B12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232408
HGNC: HGNC:6373
Homologene: 135762
Tas2r117
Name: taste receptor, type 2, member 117
Synonyms: mGR17, mt2r54, T2R17, Tas2r17
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353166
Homologene: 130073
Or10ak16
Name: olfactory receptor family 10 subfamily AK member 16
Synonyms: GA_x6K02T2QD9B-18644371-18643424, MOR259-8, Olfr1330
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258331
Homologene: 121524
Alpk1
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71481
Homologene: 11849
Opn1sw
Name: opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
Synonyms: Bcp, Short Wavelength Sensitive opsin, S Opsin, UV cone pigment, Blue/UV Opsin, Blue Opsin, SWS opsin, Blue Cone Opsin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12057
HGNC: HGNC:1012
Homologene: 1291
Trcg1
Name: taste receptor cell gene 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 541610
Homologene: 134171
Or1af1
Name: olfactory receptor family 1 subfamily AF member 1
Synonyms: Olfr366, GA_x6K02T2NLDC-33902472-33903401, MOR138-6, MOR138-5P
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 236509
Homologene: 114744
Cyp4f37
Name: cytochrome P450, family 4, subfamily f, polypeptide 37
Synonyms: Gm9705
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 677156
VEGA: 17
Homologene: 135840
Zscan4b
Name: zinc finger and SCAN domain containing 4B
Synonyms: EG665780
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665780
Homologene: 85986
Fech
Name: ferrochelatase
Synonyms: fch, Fcl
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14151
VEGA: 18
HGNC: HGNC:3647
Homologene: 113
Slc22a7
Name: solute carrier family 22 (organic anion transporter), member 7
Synonyms: OAT2, NLT
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 108114
VEGA: 17
Homologene: 21328
Ccdc177
Name: coiled-coil domain containing 177
Synonyms: LOC380768, Gm1568
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380768
VEGA: 12
Homologene: 128326
Vmn2r32
Name: vomeronasal 2, receptor 32
Synonyms: V2r5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22311
Homologene: 113703
Or8g50
Name: olfactory receptor family 8 subfamily G member 50
Synonyms: Olfr150, MOR171-18, M93, GA_x6K02T2PVTD-33434302-33435240
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258602
VEGA: 9
Tmem17
Name: transmembrane protein 17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103765
Homologene: 17795
Pagr1a
Name: PAXIP1 associated glutamate rich protein 1A
Synonyms: PA1, C77040, 2900092E17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67278
Homologene: 11563
Tacr2
Name: tachykinin receptor 2
Synonyms: Tac2r
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21337
VEGA: 10
Homologene: 55548
Gm7276
Name: predicted gene 7276
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108168393
VEGA: 18
Polr3h
Name: polymerase (RNA) III (DNA directed) polypeptide H
Synonyms: RPC8, 5031409G22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78929
VEGA: 15
Homologene: 6337
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Mpk4, Pyst3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Frmpd2
Name: FERM and PDZ domain containing 2
Synonyms: ENSMUSG00000071536, Frmpd2, LOC380890, LOC268729, Gm626
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268729
Homologene: 51854
Gm21886
Name: predicted gene, 21886
Type: Gene
Species: Mouse
Chromosome: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 14,884,198 bp
  • T to A, chromosome 1 at 90,828,133 bp
  • C to G, chromosome 1 at 146,902,010 bp
  • T to G, chromosome 1 at 158,502,349 bp
  • T to C, chromosome 2 at 36,850,466 bp
  • C to T, chromosome 2 at 37,219,762 bp
  • A to G, chromosome 2 at 139,589,617 bp
  • T to C, chromosome 2 at 147,049,346 bp
  • G to A, chromosome 3 at 40,812,178 bp
  • T to G, chromosome 3 at 90,249,089 bp
  • A to G, chromosome 3 at 127,563,071 bp
  • A to T, chromosome 3 at 127,672,494 bp
  • A to G, chromosome 3 at 127,695,733 bp
  • A to G, chromosome 4 at 98,411,139 bp
  • G to A, chromosome 4 at 111,928,561 bp
  • A to G, chromosome 4 at 116,610,588 bp
  • A to G, chromosome 4 at 117,894,871 bp
  • C to T, chromosome 4 at 118,614,931 bp
  • A to T, chromosome 4 at 118,893,130 bp
  • A to G, chromosome 4 at 134,074,123 bp
  • A to G, chromosome 5 at 89,214,647 bp
  • A to G, chromosome 5 at 96,614,889 bp
  • C to A, chromosome 5 at 123,152,576 bp
  • C to A, chromosome 5 at 137,619,623 bp
  • A to T, chromosome 6 at 29,379,857 bp
  • A to G, chromosome 6 at 41,620,239 bp
  • C to T, chromosome 6 at 129,056,345 bp
  • T to C, chromosome 6 at 132,803,229 bp
  • T to A, chromosome 7 at 7,474,213 bp
  • C to T, chromosome 7 at 10,900,864 bp
  • T to C, chromosome 7 at 10,901,893 bp
  • C to T, chromosome 7 at 30,523,052 bp
  • A to G, chromosome 7 at 103,418,368 bp
  • A to T, chromosome 7 at 110,923,756 bp
  • T to C, chromosome 7 at 127,016,564 bp
  • T to A, chromosome 7 at 141,626,136 bp
  • T to C, chromosome 8 at 37,523,411 bp
  • T to G, chromosome 8 at 69,820,499 bp
  • A to T, chromosome 9 at 18,856,789 bp
  • T to C, chromosome 9 at 39,737,126 bp
  • T to A, chromosome 9 at 57,241,483 bp
  • A to T, chromosome 9 at 72,486,778 bp
  • T to C, chromosome 9 at 110,092,898 bp
  • A to G, chromosome 9 at 114,625,903 bp
  • T to A, chromosome 10 at 30,722,851 bp
  • C to A, chromosome 10 at 62,261,648 bp
  • T to A, chromosome 10 at 100,612,829 bp
  • T to A, chromosome 10 at 116,341,138 bp
  • G to A, chromosome 11 at 6,261,720 bp
  • A to T, chromosome 11 at 22,518,645 bp
  • G to T, chromosome 11 at 77,450,108 bp
  • G to A, chromosome 11 at 79,473,414 bp
  • A to T, chromosome 11 at 113,868,083 bp
  • A to G, chromosome 12 at 80,759,018 bp
  • G to A, chromosome 12 at 100,142,250 bp
  • T to C, chromosome 13 at 24,098,810 bp
  • T to A, chromosome 14 at 6,301,955 bp
  • A to G, chromosome 14 at 33,149,584 bp
  • A to G, chromosome 14 at 33,571,969 bp
  • A to G, chromosome 14 at 43,544,538 bp
  • A to T, chromosome 14 at 52,035,853 bp
  • A to G, chromosome 15 at 6,823,567 bp
  • A to C, chromosome 15 at 57,986,425 bp
  • A to C, chromosome 15 at 66,960,533 bp
  • G to A, chromosome 15 at 81,916,401 bp
  • A to G, chromosome 16 at 18,401,600 bp
  • A to G, chromosome 17 at 32,629,844 bp
  • G to A, chromosome 17 at 44,085,264 bp
  • A to T, chromosome 17 at 46,434,627 bp
  • T to C, chromosome 18 at 34,949,029 bp
  • A to T, chromosome 18 at 64,458,184 bp
  • T to C, chromosome 18 at 77,185,487 bp
  • GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG to GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG, chromosome 18 at 80,089,752 bp
  • T to C, chromosome 19 at 8,912,528 bp
  • G to C, chromosome 19 at 53,006,291 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7412 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045493-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.