Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7412Btlr/Mmmh
Stock Number:
045493-MU
Citation ID:
RRID:MMRRC_045493-MU
Other Names:
R7412 (G1)
Major Collection:

Strain Information

Ndrg1
Name: N-myc downstream regulated gene 1
Synonyms: Tdd5, PROXY1, CMT4D, CAP43, TDD5, DRG1, Ndr1, Ndrl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17988
HGNC: HGNC:7679
Homologene: 55953
Xpnpep1
Name: X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms: D230045I08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170750
Homologene: 6424
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Lrrc16, Carmil, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Ddx56
Name: DEAD box helicase 56
Synonyms: 2600001H07Rik, NOH61, D11Ertd619e, DEAD (Asp-Glu-Ala-Asp) box polypeptide 56
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52513
Homologene: 6498
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 14,884,198 bp
  • T to A, chromosome 1 at 90,828,133 bp
  • C to G, chromosome 1 at 146,902,010 bp
  • T to G, chromosome 1 at 158,502,349 bp
  • T to C, chromosome 2 at 36,850,466 bp
  • C to T, chromosome 2 at 37,219,762 bp
  • A to G, chromosome 2 at 139,589,617 bp
  • T to C, chromosome 2 at 147,049,346 bp
  • G to A, chromosome 3 at 40,812,178 bp
  • T to G, chromosome 3 at 90,249,089 bp
  • A to G, chromosome 3 at 127,563,071 bp
  • A to T, chromosome 3 at 127,672,494 bp
  • A to G, chromosome 3 at 127,695,733 bp
  • A to G, chromosome 4 at 98,411,139 bp
  • G to A, chromosome 4 at 111,928,561 bp
  • A to G, chromosome 4 at 116,610,588 bp
  • A to G, chromosome 4 at 117,894,871 bp
  • C to T, chromosome 4 at 118,614,931 bp
  • A to T, chromosome 4 at 118,893,130 bp
  • A to G, chromosome 4 at 134,074,123 bp
  • A to G, chromosome 5 at 89,214,647 bp
  • A to G, chromosome 5 at 96,614,889 bp
  • C to A, chromosome 5 at 123,152,576 bp
  • C to A, chromosome 5 at 137,619,623 bp
  • A to T, chromosome 6 at 29,379,857 bp
  • A to G, chromosome 6 at 41,620,239 bp
  • C to T, chromosome 6 at 129,056,345 bp
  • T to C, chromosome 6 at 132,803,229 bp
  • T to A, chromosome 7 at 7,474,213 bp
  • C to T, chromosome 7 at 10,900,864 bp
  • T to C, chromosome 7 at 10,901,893 bp
  • C to T, chromosome 7 at 30,523,052 bp
  • A to G, chromosome 7 at 103,418,368 bp
  • A to T, chromosome 7 at 110,923,756 bp
  • T to C, chromosome 7 at 127,016,564 bp
  • T to A, chromosome 7 at 141,626,136 bp
  • T to C, chromosome 8 at 37,523,411 bp
  • T to G, chromosome 8 at 69,820,499 bp
  • A to T, chromosome 9 at 18,856,789 bp
  • T to C, chromosome 9 at 39,737,126 bp
  • T to A, chromosome 9 at 57,241,483 bp
  • A to T, chromosome 9 at 72,486,778 bp
  • T to C, chromosome 9 at 110,092,898 bp
  • A to G, chromosome 9 at 114,625,903 bp
  • T to A, chromosome 10 at 30,722,851 bp
  • C to A, chromosome 10 at 62,261,648 bp
  • T to A, chromosome 10 at 100,612,829 bp
  • T to A, chromosome 10 at 116,341,138 bp
  • G to A, chromosome 11 at 6,261,720 bp
  • A to T, chromosome 11 at 22,518,645 bp
  • G to T, chromosome 11 at 77,450,108 bp
  • G to A, chromosome 11 at 79,473,414 bp
  • A to T, chromosome 11 at 113,868,083 bp
  • A to G, chromosome 12 at 80,759,018 bp
  • G to A, chromosome 12 at 100,142,250 bp
  • T to C, chromosome 13 at 24,098,810 bp
  • T to A, chromosome 14 at 6,301,955 bp
  • A to G, chromosome 14 at 33,149,584 bp
  • A to G, chromosome 14 at 33,571,969 bp
  • A to G, chromosome 14 at 43,544,538 bp
  • A to T, chromosome 14 at 52,035,853 bp
  • A to G, chromosome 15 at 6,823,567 bp
  • A to C, chromosome 15 at 57,986,425 bp
  • A to C, chromosome 15 at 66,960,533 bp
  • G to A, chromosome 15 at 81,916,401 bp
  • A to G, chromosome 16 at 18,401,600 bp
  • A to G, chromosome 17 at 32,629,844 bp
  • G to A, chromosome 17 at 44,085,264 bp
  • A to T, chromosome 17 at 46,434,627 bp
  • T to C, chromosome 18 at 34,949,029 bp
  • A to T, chromosome 18 at 64,458,184 bp
  • T to C, chromosome 18 at 77,185,487 bp
  • GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG to GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG, chromosome 18 at 80,089,752 bp
  • T to C, chromosome 19 at 8,912,528 bp
  • G to C, chromosome 19 at 53,006,291 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7412 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045493-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.