Strain Name:
C57BL/6J-MtgxR7464Btlr/Mmmh
Stock Number:
045538-MU
Citation ID:
RRID:MMRRC_045538-MU
Other Names:
R7464 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269132
Homologene: 22865
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Zmym1
Name: zinc finger, MYM domain containing 1
Synonyms: 5830412B09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68310
Homologene: 32904
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 1100001C18Rik, A330076K04Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Pde1b
Name: phosphodiesterase 1B, Ca2+-calmodulin dependent
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18574
VEGA: 15
HGNC: HGNC:8775
Homologene: 37370
Mllt10
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 10
Synonyms: Af10, D630001B22Rik, B130021D15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17354
Homologene: 20973
Emc8
Name: ER membrane protein complex subunit 8
Synonyms: Noc4, Fam158b, Cox4nb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18117
HGNC: HGNC:7864
Homologene: 4424
Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: SREBP-2, nuc, SREBP2, SREBP2gc, bHLHd2, lop13
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Wac
Name: WW domain containing adaptor with coiled-coil
Synonyms: 1110067P07Rik, Wwp4, A230035H12Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225131
Homologene: 41148
Ubr1
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22222
Homologene: 7582
Baz2a
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Tip5, Walp3, C030005G16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 116848
VEGA: 10
HGNC: HGNC:962
Homologene: 8393
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Asxl1
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228790
Homologene: 9098
Zfyve1
Name: zinc finger, FYVE domain containing 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217695
VEGA: 12
Homologene: 10945
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Tacc1
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: 4833447E04Rik, Tacc1, B230378H13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320165
Homologene: 4575
Soat1
Name: sterol O-acyltransferase 1
Synonyms: ACAT-1, Acact, 8430426K15Rik, hid
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20652
Homologene: 2333
Crebrf
Name: CREB3 regulatory factor
Synonyms: A930001N09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77128
Homologene: 12672
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: A830080H02Rik, 2610016F01Rik, Tnrc15
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227331
Homologene: 41048
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320661
Homologene: 19716
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: 6030441H18Rik, Mtmr15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330554
Homologene: 45598
Dram2
Name: DNA-damage regulated autophagy modulator 2
Synonyms: 2010305N14Rik, 2610318G18Rik, Tmem77
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67171
Homologene: 23565
Nktr
Name: natural killer tumor recognition sequence
Synonyms: D9Wsu172e, 5330401F18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18087
HGNC: HGNC:7833
Homologene: 122148
Zfp748
Name: zinc finger protein 748
Synonyms: Zfp208, KRAB-O, mszf54, 2610014M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212276
Homologene: 134552
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215690
Homologene: 10719
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Tapt1
Name: transmembrane anterior posterior transformation 1
Synonyms: 4932414K18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231225
Homologene: 80206
Tmem178
Name: transmembrane protein 178
Synonyms: 2810417M05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68027
VEGA: 17
Homologene: 12226
Tmem52
Name: transmembrane protein 52
Synonyms: 2310043I08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69671
Homologene: 18680
Cngb1
Name: cyclic nucleotide gated channel beta 1
Synonyms: Cngb1, Cngb1b, BC016201
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 333329
HGNC: HGNC:2151
Homologene: 136420
Mb21d2
Name: Mab-21 domain containing 2
Synonyms: 1600021P15Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239796
VEGA: 16
Homologene: 18614
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Tulp3
Name: TUB like protein 3
Synonyms: 2310022L06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22158
Homologene: 20711
Klhl6
Name: kelch-like 6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239743
Homologene: 15603
Acta2
Name: actin alpha 2, smooth muscle, aorta
Synonyms: Actvs, a-SMA, 0610041G09Rik, SMalphaA, alphaSMA, SMAalpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11475
VEGA: 19
HGNC: HGNC:130
Homologene: 133938
Mlxipl
Name: MLX interacting protein-like
Synonyms: WS-bHLH, ChREBP, Wbscr14, bHLHd14
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 58805
Homologene: 32507
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 631797
Homologene: 53396
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, Jr4, ZIZ3, 9330153B10Rik, A630054M16Rik, Zizimin3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Kcna10
Name: potassium voltage-gated channel, shaker-related subfamily, member 10
Synonyms: Kv1.8, Kcna8
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242151
HGNC: HGNC:6219
Homologene: 4054
Cyp2j11
Name: cytochrome P450, family 2, subfamily j, polypeptide 11
Synonyms: Cyp2j11-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100066
HGNC: HGNC:2634
Homologene: 133819
Csf1
Name: colony stimulating factor 1 (macrophage)
Synonyms: CSF-1, M-CSF, colony-stimulating factor-1, Csfm, BAP025
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12977
HGNC: HGNC:2432
Homologene: 7282
H2-M9
Name: histocompatibility 2, M region locus 9
Synonyms: M9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14997
Homologene: 110792
Il25
Name: interleukin 25
Synonyms: IL-17E, Il17e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140806
VEGA: 14
Homologene: 15429
Fbxw16
Name: F-box and WD-40 domain protein 16
Synonyms: 7420402K12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320083
Homologene: 110776
Ankar
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319695
Homologene: 85163
Mdm1
Name: MDM1 nuclear protein
Synonyms: Mdm-1, transformed mouse 3T3 cell double minute 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17245
VEGA: 10
Homologene: 9692
Cd19
Name: CD19 antigen
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12478
HGNC: HGNC:1633
Homologene: 1341
Fbxw10
Name: F-box and WD-40 domain protein 10
Synonyms: SM2SH2, SM25H2, Fbw10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 213980
Homologene: 32757
Tmem94
Name: transmembrane protein 94
Synonyms: 2310067B10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71947
Homologene: 8831
St8sia3
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Synonyms: ST8SiaIII, Siat8c
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20451
Homologene: 8285
Ddx60
Name: DExD/H box helicase 60
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234311
Homologene: 23031
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Tbc1d9b
Name: TBC1 domain family, member 9B
Synonyms: 2700008N14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76795
Homologene: 28106
Polg2
Name: polymerase (DNA directed), gamma 2, accessory subunit
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50776
HGNC: HGNC:9180
Homologene: 5221
C5ar1
Name: complement component 5a receptor 1
Synonyms: C5aR, Cd88, C5r1, D7Msu1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12273
HGNC: HGNC:1338
Homologene: 20413
Thumpd3
Name: THUMP domain containing 3
Synonyms: Gtrosa26as
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14911
Homologene: 7351
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30956
Homologene: 4212
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
Zfp286
Name: zinc finger protein 286
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192651
Homologene: 56892
Vcpip1
Name: valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms: Vcip135, 5730538E15Rik, 5730421J18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70675
Homologene: 11814
Slc28a3
Name: solute carrier family 28 (sodium-coupled nucleoside transporter), member 3
Synonyms: Cnt3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 114304
Homologene: 32533
Vmn2r49
Name: vomeronasal 2, receptor 49
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 625605
Homologene: 113703
Tchhl1
Name: trichohyalin-like 1
Synonyms: S100a17, Thhl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71325
Homologene: 84625
Cdc14b
Name: CDC14 cell division cycle 14B
Synonyms: 2810432N10Rik, A530086E13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218294
VEGA: 13
Homologene: 104197
Galnt7
Name: polypeptide N-acetylgalactosaminyltransferase 7
Synonyms: ppGaNTase-T7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108150
HGNC: HGNC:4129
Homologene: 9685
Or4g17
Name: olfactory receptor family 4 subfamily G member 17
Synonyms: GA_x6K02T2Q125-72430580-72431515, MOR245-13, Olfr1284
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258379
Homologene: 74059
Stx5a
Name: syntaxin 5A
Synonyms: syntaxin 5, 0610031F24Rik, D19Ertd627e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56389
Homologene: 2381
Nars2
Name: asparaginyl-tRNA synthetase 2 (mitochondrial)(putative)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244141
Homologene: 57002
Tacc3
Name: transforming, acidic coiled-coil containing protein 3
Synonyms: Arnt interacting protein, Aint
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21335
Homologene: 81618
Zfp873
Name: zinc finger protein 873
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 408062
Homologene: 134319
Ptpn18
Name: protein tyrosine phosphatase, non-receptor type 18
Synonyms: HSCF, FLP1, Ptpk1, PTP-K1, PTP-HSCF
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19253
HGNC: HGNC:9649
Homologene: 74971
Or14j8
Name: olfactory receptor family 14 subfamily J member 8
Synonyms: GA_x6K02T2PSCP-2403971-2403000, MOR218-6P, MOR218-5P, MOR218-6P, MOR218-12, Olfr1552-ps1, Olfr761
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258094
Homologene: 134080
Or2a57
Name: olfactory receptor family 2 subfamily A member 57
Synonyms: IB12, MOR261-9, GA_x6K02T2P3E9-4322325-4321360, Olfr47
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18346
Homologene: 133700
Apof
Name: apolipoprotein F
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103161
VEGA: 10
HGNC: HGNC:615
Homologene: 48030
Oxld1
Name: oxidoreductase like domain containing 1
Synonyms: 1810049H13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66431
Homologene: 49831
Spopfm2
Name: speckle-type BTB/POZ protein family member 2
Synonyms: Gm10696
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100043188
Homologene: 128308
Bbc3
Name: BCL2 binding component 3
Synonyms: PUMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170770
Homologene: 8679
Six4
Name: sine oculis-related homeobox 4
Synonyms: AREC3, TrexBF
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20474
Homologene: 69089
Fam162a
Name: family with sequence similarity 162, member A
Synonyms: 2310056P07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70186
VEGA: 16
Homologene: 8656
Defa40
Name: defensin, alpha, 40
Synonyms: ENSMUSG00000074441, Gm15292
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100041787
Homologene: 113382
Gm5447
Name: predicted gene 5447
Type: Gene
Species: Mouse
Chromosome: 13
Gm28729
Name: predicted gene 28729
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102635744
Homologene: 139355
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 9,746,520 bp
  • G to A, chromosome 1 at 34,473,364 bp
  • A to T, chromosome 1 at 72,698,894 bp
  • T to C, chromosome 1 at 80,540,315 bp
  • T to C, chromosome 1 at 87,428,604 bp
  • T to A, chromosome 1 at 135,584,909 bp
  • A to G, chromosome 1 at 152,504,144 bp
  • A to T, chromosome 1 at 156,439,317 bp
  • T to A, chromosome 2 at 18,170,279 bp
  • T to C, chromosome 2 at 52,193,890 bp
  • T to A, chromosome 2 at 59,308,137 bp
  • T to C, chromosome 2 at 59,977,448 bp
  • T to A, chromosome 2 at 111,379,198 bp
  • A to G, chromosome 2 at 120,889,774 bp
  • G to T, chromosome 2 at 153,397,785 bp
  • G to A, chromosome 3 at 93,470,664 bp
  • A to T, chromosome 3 at 94,176,104 bp
  • T to A, chromosome 3 at 96,648,155 bp
  • T to C, chromosome 3 at 106,573,683 bp
  • A to T, chromosome 3 at 107,194,079 bp
  • T to A, chromosome 3 at 107,748,875 bp
  • C to A, chromosome 4 at 96,345,120 bp
  • T to A, chromosome 4 at 127,058,935 bp
  • C to T, chromosome 4 at 155,469,469 bp
  • A to G, chromosome 5 at 33,661,284 bp
  • G to A, chromosome 5 at 36,613,785 bp
  • G to A, chromosome 5 at 44,188,688 bp
  • C to T, chromosome 5 at 93,636,240 bp
  • T to C, chromosome 5 at 135,133,628 bp
  • C to T, chromosome 6 at 23,077,153 bp
  • T to G, chromosome 6 at 43,236,294 bp
  • G to A, chromosome 6 at 113,055,769 bp
  • A to T, chromosome 6 at 128,326,829 bp
  • A to C, chromosome 7 at 9,988,893 bp
  • T to A, chromosome 7 at 16,248,766 bp
  • A to T, chromosome 7 at 16,317,157 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • A to G, chromosome 7 at 97,039,930 bp
  • C to A, chromosome 7 at 126,411,803 bp
  • T to A, chromosome 8 at 21,249,894 bp
  • T to C, chromosome 8 at 25,164,464 bp
  • C to T, chromosome 8 at 33,335,996 bp
  • A to G, chromosome 8 at 57,584,020 bp
  • C to T, chromosome 8 at 61,940,674 bp
  • G to A, chromosome 8 at 70,333,423 bp
  • C to A, chromosome 8 at 95,254,183 bp
  • A to G, chromosome 8 at 120,667,918 bp
  • A to G, chromosome 9 at 96,521,235 bp
  • A to G, chromosome 9 at 109,439,551 bp
  • A to C, chromosome 9 at 121,750,327 bp
  • T to C, chromosome 10 at 8,756,745 bp
  • A to G, chromosome 10 at 82,060,376 bp
  • T to C, chromosome 10 at 118,152,266 bp
  • T to A, chromosome 10 at 128,122,073 bp
  • A to G, chromosome 10 at 128,269,636 bp
  • T to G, chromosome 11 at 34,695,278 bp
  • T to A, chromosome 11 at 50,131,485 bp
  • C to A, chromosome 11 at 62,780,801 bp
  • T to A, chromosome 11 at 62,853,298 bp
  • C to A, chromosome 11 at 106,773,714 bp
  • G to A, chromosome 11 at 107,636,278 bp
  • G to T, chromosome 11 at 115,786,256 bp
  • T to C, chromosome 11 at 120,457,137 bp
  • T to C, chromosome 12 at 73,112,530 bp
  • C to T, chromosome 12 at 83,551,487 bp
  • A to G, chromosome 13 at 30,974,394 bp
  • A to C, chromosome 13 at 58,563,021 bp
  • A to T, chromosome 13 at 64,196,675 bp
  • A to G, chromosome 13 at 67,541,972 bp
  • A to G, chromosome 14 at 54,933,222 bp
  • T to C, chromosome 15 at 9,740,585 bp
  • T to A, chromosome 15 at 58,573,247 bp
  • T to A, chromosome 15 at 82,172,874 bp
  • T to C, chromosome 15 at 103,524,829 bp
  • G to T, chromosome 16 at 19,957,113 bp
  • T to G, chromosome 16 at 28,929,546 bp
  • A to G, chromosome 16 at 36,071,493 bp
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp
  • A to G, chromosome 17 at 26,763,487 bp
  • A to T, chromosome 17 at 36,642,411 bp
  • A to T, chromosome 17 at 37,952,280 bp
  • C to T, chromosome 17 at 80,944,902 bp
  • T to C, chromosome 18 at 7,871,746 bp
  • T to C, chromosome 18 at 64,271,518 bp
  • T to A, chromosome 19 at 8,743,504 bp
  • G to A, chromosome 19 at 34,252,531 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7464 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045538-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.