Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7464Btlr/Mmmh
Stock Number:
045538-MU
Citation ID:
RRID:MMRRC_045538-MU
Other Names:
R7464 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269132
Homologene: 22865
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Zmym1
Name: zinc finger, MYM domain containing 1
Synonyms: 5830412B09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68310
Homologene: 32904
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Pde1b
Name: phosphodiesterase 1B, Ca2+-calmodulin dependent
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18574
VEGA: 15
HGNC: HGNC:8775
Homologene: 37370
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 9,746,520 bp
  • G to A, chromosome 1 at 34,473,364 bp
  • A to T, chromosome 1 at 72,698,894 bp
  • T to C, chromosome 1 at 80,540,315 bp
  • T to C, chromosome 1 at 87,428,604 bp
  • T to A, chromosome 1 at 135,584,909 bp
  • A to G, chromosome 1 at 152,504,144 bp
  • A to T, chromosome 1 at 156,439,317 bp
  • T to A, chromosome 2 at 18,170,279 bp
  • T to C, chromosome 2 at 52,193,890 bp
  • T to A, chromosome 2 at 59,308,137 bp
  • T to C, chromosome 2 at 59,977,448 bp
  • T to A, chromosome 2 at 111,379,198 bp
  • A to G, chromosome 2 at 120,889,774 bp
  • G to T, chromosome 2 at 153,397,785 bp
  • G to A, chromosome 3 at 93,470,664 bp
  • A to T, chromosome 3 at 94,176,104 bp
  • T to A, chromosome 3 at 96,648,155 bp
  • T to C, chromosome 3 at 106,573,683 bp
  • A to T, chromosome 3 at 107,194,079 bp
  • T to A, chromosome 3 at 107,748,875 bp
  • C to A, chromosome 4 at 96,345,120 bp
  • T to A, chromosome 4 at 127,058,935 bp
  • C to T, chromosome 4 at 155,469,469 bp
  • A to G, chromosome 5 at 33,661,284 bp
  • G to A, chromosome 5 at 36,613,785 bp
  • G to A, chromosome 5 at 44,188,688 bp
  • C to T, chromosome 5 at 93,636,240 bp
  • T to C, chromosome 5 at 135,133,628 bp
  • C to T, chromosome 6 at 23,077,153 bp
  • T to G, chromosome 6 at 43,236,294 bp
  • G to A, chromosome 6 at 113,055,769 bp
  • A to T, chromosome 6 at 128,326,829 bp
  • A to C, chromosome 7 at 9,988,893 bp
  • T to A, chromosome 7 at 16,248,766 bp
  • A to T, chromosome 7 at 16,317,157 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • A to G, chromosome 7 at 97,039,930 bp
  • C to A, chromosome 7 at 126,411,803 bp
  • T to A, chromosome 8 at 21,249,894 bp
  • T to C, chromosome 8 at 25,164,464 bp
  • C to T, chromosome 8 at 33,335,996 bp
  • A to G, chromosome 8 at 57,584,020 bp
  • C to T, chromosome 8 at 61,940,674 bp
  • G to A, chromosome 8 at 70,333,423 bp
  • C to A, chromosome 8 at 95,254,183 bp
  • A to G, chromosome 8 at 120,667,918 bp
  • A to G, chromosome 9 at 96,521,235 bp
  • A to G, chromosome 9 at 109,439,551 bp
  • A to C, chromosome 9 at 121,750,327 bp
  • T to C, chromosome 10 at 8,756,745 bp
  • A to G, chromosome 10 at 82,060,376 bp
  • T to C, chromosome 10 at 118,152,266 bp
  • T to A, chromosome 10 at 128,122,073 bp
  • A to G, chromosome 10 at 128,269,636 bp
  • T to G, chromosome 11 at 34,695,278 bp
  • T to A, chromosome 11 at 50,131,485 bp
  • C to A, chromosome 11 at 62,780,801 bp
  • T to A, chromosome 11 at 62,853,298 bp
  • C to A, chromosome 11 at 106,773,714 bp
  • G to A, chromosome 11 at 107,636,278 bp
  • G to T, chromosome 11 at 115,786,256 bp
  • T to C, chromosome 11 at 120,457,137 bp
  • T to C, chromosome 12 at 73,112,530 bp
  • C to T, chromosome 12 at 83,551,487 bp
  • A to G, chromosome 13 at 30,974,394 bp
  • A to C, chromosome 13 at 58,563,021 bp
  • A to T, chromosome 13 at 64,196,675 bp
  • A to G, chromosome 13 at 67,541,972 bp
  • A to G, chromosome 14 at 54,933,222 bp
  • T to C, chromosome 15 at 9,740,585 bp
  • T to A, chromosome 15 at 58,573,247 bp
  • T to A, chromosome 15 at 82,172,874 bp
  • T to C, chromosome 15 at 103,524,829 bp
  • G to T, chromosome 16 at 19,957,113 bp
  • T to G, chromosome 16 at 28,929,546 bp
  • A to G, chromosome 16 at 36,071,493 bp
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp
  • A to G, chromosome 17 at 26,763,487 bp
  • A to T, chromosome 17 at 36,642,411 bp
  • A to T, chromosome 17 at 37,952,280 bp
  • C to T, chromosome 17 at 80,944,902 bp
  • T to C, chromosome 18 at 7,871,746 bp
  • T to C, chromosome 18 at 64,271,518 bp
  • T to A, chromosome 19 at 8,743,504 bp
  • G to A, chromosome 19 at 34,252,531 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7464 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045538-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.