Strain Name:
C57BL/6J-MtgxR7483Btlr/Mmmh
Stock Number:
045557-MU
Citation ID:
RRID:MMRRC_045557-MU
Other Names:
R7483 (G1)
Major Collection:

Strain Information

Chrna7
Name: cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms: Acra7, alpha7 nicotinic receptor, alpha7, alpha7-nAChR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11441
Homologene: 593
Ash2l
Name: ASH2 like histone lysine methyltransferase complex subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23808
HGNC: HGNC:744
Homologene: 3436
Srpk1
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20815
Homologene: 110962
Hdac11
Name: histone deacetylase 11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232232
Homologene: 11743
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Usp38
Name: ubiquitin specific peptidase 38
Synonyms: 4631402N15Rik, 4833420O05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74841
Homologene: 12367
Jpt1
Name: Jupiter microtubule associated homolog 1
Synonyms: Hn1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15374
Homologene: 7364
Larp4
Name: La ribonucleoprotein 4
Synonyms: D330037H05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 207214
VEGA: 15
Homologene: 19173
Braf
Name: Braf transforming gene
Synonyms: Braf-2, Braf2, D6Ertd631e, 9930012E13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109880
HGNC: HGNC:1097
Homologene: 3197
Brwd1
Name: bromodomain and WD repeat domain containing 1
Synonyms: repro5, D530019K20Rik, G1-403-16, Wdr9, 5330419I02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 93871
Homologene: 23130
Akap12
Name: A kinase anchor protein 12
Synonyms: SSeCKS, Srcs5, Tsga12
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83397
VEGA: 10
HGNC: HGNC:370
Homologene: 3740
Dmbx1
Name: diencephalon/mesencephalon homeobox 1
Synonyms: Otx3, Mbx, Dmbx1, Cdmx, Atx
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140477
Homologene: 15639
Nfrkb
Name: nuclear factor related to kappa B binding protein
Synonyms: A530090G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235134
HGNC: HGNC:7802
Homologene: 4492
Nol6
Name: nucleolar protein family 6 (RNA-associated)
Synonyms: Nrap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230082
Homologene: 41505
Trhr
Name: thyrotropin releasing hormone receptor
Synonyms: TRH-R1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22045
VEGA: 15
Homologene: 20707
Upf2
Name: UPF2 regulator of nonsense transcripts homolog (yeast)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 326622
Homologene: 6101
Cemip
Name: cell migration inducing protein, hyaluronan binding
Synonyms: 9930013L23Rik, 12H19.01.T7, Hybid, 6330404C01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80982
Homologene: 10268
Mcm4
Name: minichromosome maintenance complex component 4
Synonyms: 19G, Mcmd4, Cdc21, mCdc21
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17217
VEGA: 16
HGNC: HGNC:6947
Homologene: 40496
Fat1
Name: FAT atypical cadherin 1
Synonyms: 2310038E12Rik, Fath, mFat1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Ints2
Name: integrator complex subunit 2
Synonyms: 2810417D08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70422
Homologene: 10801
Tusc3
Name: tumor suppressor candidate 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80286
Homologene: 6937
Rad54b
Name: RAD54 homolog B (S. cerevisiae)
Synonyms: E130016E03Rik, E130016E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 623474
Homologene: 8240
Peg10
Name: paternally expressed 10
Synonyms: MyEF-3, HB-1, Mart2, MEF3L, MyEF-3 like, Mar2, Edr, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Enam
Name: enamelin
Synonyms: abte
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13801
HGNC: HGNC:3344
Homologene: 9698
Myo7a
Name: myosin VIIA
Synonyms: nmf371, Hdb, polka, USH1B, Myo7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: C130041O22Rik, Zfh-4, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Bmper
Name: BMP-binding endothelial regulator
Synonyms: 3110056H04Rik, CV-2, Cv2, crossveinless-2, Crim3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73230
VEGA: 9
Homologene: 12494
Ttn
Name: titin
Synonyms: 2310074I15Rik, D330041I19Rik, 2310057K23Rik, connectin, 2310036G12Rik, shru, D830007G01Rik, L56, 1100001C23Rik, mdm
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Pico, Acz
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Acad10
Name: acyl-Coenzyme A dehydrogenase family, member 10
Synonyms: 2410021P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71985
Homologene: 49825
Kdm5d
Name: lysine demethylase 5D
Synonyms: HY, Jarid1d, Smcy
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 20592
Homologene: 55838
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 631797
Homologene: 53396
Zfp458
Name: zinc finger protein 458
Synonyms: Rslcan-7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238690
VEGA: 13
Homologene: 128170
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, ZIZ3, 9330153B10Rik, Zizimin3, A630054M16Rik, Jr4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Nalcn
Name: sodium leak channel, non-selective
Synonyms: Vgcnl1, A530023G15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Vmn2r115
Name: vomeronasal 2, receptor 115
Synonyms: V2Rp4, EG638102
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638102
Homologene: 86604
Gucy2d
Name: guanylate cyclase 2d
Synonyms: guanylyl cyclase D
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14918
Homologene: 71540
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Tmx4
Name: thioredoxin-related transmembrane protein 4
Synonyms: Txndc13, 2810417D04Rik, 4930500L08Rik, D2Bwg1356e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 52837
Homologene: 10901
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Or11g27
Name: olfactory receptor family 11 subfamily G member 27
Synonyms: Olfr743-ps1, Olfr265, Olfr743, GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, MOR106-14, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, Olfr264
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219019
Homologene: 74163
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 1300010F03Rik, 4932416F07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Ahnak
Name: AHNAK nucleoprotein
Synonyms: 1110004P15Rik, DY6, 2310047C17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Pde8a
Name: phosphodiesterase 8A
Synonyms: Pde8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18584
HGNC: HGNC:8793
Homologene: 1957
Ugt2b38
Name: UDP glucuronosyltransferase 2 family, polypeptide B38
Synonyms: 9430041C03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100559
Homologene: 137225
Myo15b
Name: myosin XVB
Synonyms: E330039G21Rik, LOC380737, LOC217328
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217328
Nrxn3
Name: neurexin III
Synonyms: 4933401A11Rik, neurexin III beta, 9330112C09Rik, neurexin III alpha, neurexin III beta, neurexin III alpha, D12Bwg0831e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18191
HGNC: HGNC:8010
Homologene: 83225
Hoxa2
Name: homeobox A2
Synonyms: Hox-1.11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15399
HGNC: HGNC:5103
Homologene: 4901
Pik3cg
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
Synonyms: p110gamma, PI3Kgamma, PI(3)Kgamma, 5830428L06Rik, PI3Kgamma
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 30955
HGNC: HGNC:8978
Homologene: 68269
Vmn1r216
Name: vomeronasal 1 receptor 216
Synonyms: V1ri10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171279
Homologene: 110880
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Slc45a3
Name: solute carrier family 45, member 3
Synonyms: Pcanap6, 2210413P12Rik, IPCA-6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212980
HGNC: HGNC:8642
Homologene: 23813
Psd4
Name: pleckstrin and Sec7 domain containing 4
Synonyms: SEC7 homolog, EFA6B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215632
Homologene: 8261
Ranbp3l
Name: RAN binding protein 3-like
Synonyms: C130037N17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223332
VEGA: 15
Homologene: 35407
Sdcbp
Name: syndecan binding protein
Synonyms: syntenin, syntenin-1, syndecan interacting protein, MDA-9, Sycl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53378
Homologene: 4110
Mex3b
Name: mex3 RNA binding family member B
Synonyms: Rkhd3, 4931439A04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108797
Homologene: 13570
Or4f15
Name: olfactory receptor family 4 subfamily F member 15
Synonyms: MOR245-5, Olfr1309, GA_x6K02T2Q125-73031456-73030518
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258439
Homologene: 74054
Zfp687
Name: zinc finger protein 687
Synonyms: 4931408L03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78266
Homologene: 10827
Wnt7b
Name: wingless-type MMTV integration site family, member 7B
Synonyms: Wnt-7b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22422
VEGA: 15
Homologene: 22531
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: Rsn, Clip 170, Clip50, CLIP-170, cytoplasmic linker protein 50, restin, 1110007I12Rik, 4631429H07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: VE-PTP, 3230402H02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Rbm12
Name: RNA binding motif protein 12
Synonyms: 9430070C08Rik, SWAN, 5730420G12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75710
HGNC: HGNC:9898
Homologene: 34993
Slc25a24
Name: solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 24
Synonyms: 2610016M12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229731
Homologene: 92693
Lmo3
Name: LIM domain only 3
Synonyms: Rbtn-3, Rbtn3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109593
HGNC: HGNC:6643
Homologene: 38552
Pde8b
Name: phosphodiesterase 8B
Synonyms: B230331L10Rik, C030047E14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218461
HGNC: HGNC:8794
Homologene: 2758
Or10ak11
Name: olfactory receptor family 10 subfamily AK member 11
Synonyms: Olfr1333, MOR259-11, MOR259-6, GA_x6K02T2QD9B-18703033-18703986
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258265
Homologene: 134082
Nudcd1
Name: NudC domain containing 1
Synonyms: 4921532K09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67429
VEGA: 15
Homologene: 12128
Atp8a2
Name: ATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonyms: wl, Ib, agil
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50769
Homologene: 4443
Tspoap1
Name: TSPO associated protein 1
Synonyms: Bzrap1, peripheral
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207777
Homologene: 37961
Efcab3
Name: EF-hand calcium binding domain 3
Synonyms: Gm11639, 4921510J17Rik, Efcab15, Efcab13, Gm11639
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108167860
Homologene: 18304
Cplane2
Name: ciliogenesis and planar polarity effector 2
Synonyms: LOC279260, b2b2804Clo, 6330545A04Rik, Rsg1, b2b2827Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76166
Homologene: 12793
Zp1
Name: zona pellucida glycoprotein 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22786
Homologene: 33483
Arhgap24
Name: Rho GTPase activating protein 24
Synonyms: 0610025G21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231532
Homologene: 32754
Cyp2c68
Name: cytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms: 9030012A22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433247
Homologene: 74936
Fam161a
Name: family with sequence similarity 161, member A
Synonyms: 4930430E16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73873
Homologene: 19131
Oscp1
Name: organic solute carrier partner 1
Synonyms: 6030436A01Rik, 1810007P19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230751
Homologene: 71010
Fdxacb1
Name: ferredoxin-fold anticodon binding domain containing 1
Synonyms: D630004A14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382137
Homologene: 19813
Catsper4
Name: cation channel, sperm associated 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329954
Homologene: 18638
Obox2
Name: oocyte specific homeobox 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246792
Homologene: 44937
Hcar2
Name: hydroxycarboxylic acid receptor 2
Synonyms: Gpr109a, Pumag, HM74, PUMA-G, Niacr1, Gpr109b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80885
Homologene: 4391
Xbp1
Name: X-box binding protein 1
Synonyms: TREB5, D11Ertd39e, TREB-5, XBP-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22433
Homologene: 3722
Onecut3
Name: one cut domain, family member 3
Synonyms: OC-3, Oc3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 246086
Homologene: 82258
Med8
Name: mediator complex subunit 8
Synonyms: 2210021A15Rik, ARC32
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 80509
Homologene: 10560
Or2d2b
Name: olfactory receptor family 2 subfamily D member 2B
Synonyms: Olfr715b, Gm10081, EG384732
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384732
HGNC: HGNC:8244
Homologene: 81541
Apof
Name: apolipoprotein F
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103161
VEGA: 10
HGNC: HGNC:615
Homologene: 48030
Eid2b
Name: EP300 interacting inhibitor of differentiation 2B
Synonyms: 3010005C08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434156
Homologene: 51846
Myocos
Name: myocilin opposite strand
Synonyms: 7420461P10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100038657
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 46,175,419 bp
  • T to C, chromosome 1 at 80,515,566 bp
  • G to T, chromosome 1 at 131,976,811 bp
  • T to A, chromosome 1 at 162,657,109 bp
  • A to G, chromosome 2 at 6,027,408 bp
  • A to T, chromosome 2 at 24,404,756 bp
  • A to G, chromosome 2 at 66,533,348 bp
  • A to T, chromosome 2 at 76,951,512 bp
  • T to C, chromosome 2 at 111,983,779 bp
  • A to G, chromosome 2 at 134,639,661 bp
  • T to C, chromosome 2 at 156,098,218 bp
  • A to G, chromosome 3 at 5,412,177 bp
  • C to T, chromosome 3 at 95,007,530 bp
  • A to G, chromosome 3 at 109,159,435 bp
  • T to C, chromosome 4 at 6,393,089 bp
  • A to G, chromosome 4 at 11,610,372 bp
  • A to G, chromosome 4 at 41,117,424 bp
  • G to T, chromosome 4 at 115,923,711 bp
  • A to G, chromosome 4 at 118,410,979 bp
  • A to G, chromosome 4 at 118,830,320 bp
  • C to T, chromosome 4 at 126,073,933 bp
  • A to T, chromosome 4 at 134,218,241 bp
  • A to G, chromosome 4 at 141,219,842 bp
  • A to T, chromosome 5 at 14,712,592 bp
  • A to G, chromosome 5 at 87,424,114 bp
  • A to G, chromosome 5 at 88,501,820 bp
  • A to G, chromosome 5 at 90,299,996 bp
  • T to A, chromosome 5 at 102,841,308 bp
  • A to T, chromosome 5 at 121,656,012 bp
  • A to T, chromosome 5 at 123,617,384 bp
  • T to A, chromosome 5 at 123,864,798 bp
  • A to T, chromosome 5 at 137,446,795 bp
  • T to TCCG, chromosome 6 at 4,756,451 bp
  • T to C, chromosome 6 at 39,627,838 bp
  • C to A, chromosome 6 at 52,164,299 bp
  • C to T, chromosome 6 at 91,159,232 bp
  • C to T, chromosome 6 at 138,416,502 bp
  • C to T, chromosome 7 at 12,670,828 bp
  • T to C, chromosome 7 at 15,397,316 bp
  • T to G, chromosome 7 at 28,277,818 bp
  • C to A, chromosome 7 at 63,104,990 bp
  • T to C, chromosome 7 at 81,282,833 bp
  • G to T, chromosome 7 at 82,867,906 bp
  • T to G, chromosome 7 at 83,998,576 bp
  • T to A, chromosome 7 at 98,063,674 bp
  • T to A, chromosome 7 at 98,449,757 bp
  • T to A, chromosome 7 at 107,106,775 bp
  • T to C, chromosome 7 at 141,639,823 bp
  • G to T, chromosome 8 at 25,822,770 bp
  • A to G, chromosome 8 at 39,071,481 bp
  • A to G, chromosome 8 at 45,023,160 bp
  • C to T, chromosome 8 at 81,014,561 bp
  • A to T, chromosome 8 at 104,549,584 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 23,483,942 bp
  • C to T, chromosome 9 at 31,414,032 bp
  • C to A, chromosome 9 at 50,770,151 bp
  • T to G, chromosome 10 at 4,353,967 bp
  • A to T, chromosome 10 at 80,495,476 bp
  • A to G, chromosome 10 at 116,283,429 bp
  • A to T, chromosome 10 at 128,268,767 bp
  • T to C, chromosome 11 at 5,521,098 bp
  • A to T, chromosome 11 at 23,021,006 bp
  • A to G, chromosome 11 at 86,215,618 bp
  • A to T, chromosome 11 at 87,761,525 bp
  • A to G, chromosome 11 at 105,109,286 bp
  • T to C, chromosome 11 at 115,503,124 bp
  • A to T, chromosome 11 at 115,858,744 bp
  • T to C, chromosome 12 at 32,195,648 bp
  • T to C, chromosome 12 at 89,510,462 bp
  • A to G, chromosome 13 at 23,099,568 bp
  • A to G, chromosome 13 at 67,256,914 bp
  • T to A, chromosome 13 at 95,027,743 bp
  • T to A, chromosome 14 at 50,534,015 bp
  • A to T, chromosome 14 at 60,008,375 bp
  • A to C, chromosome 14 at 78,982,234 bp
  • T to C, chromosome 14 at 96,346,868 bp
  • A to G, chromosome 14 at 123,314,087 bp
  • T to A, chromosome 15 at 9,002,132 bp
  • T to A, chromosome 15 at 44,229,231 bp
  • A to G, chromosome 15 at 44,405,857 bp
  • A to T, chromosome 15 at 58,641,945 bp
  • C to A, chromosome 15 at 85,537,414 bp
  • A to G, chromosome 15 at 99,991,778 bp
  • A to G, chromosome 16 at 15,630,442 bp
  • T to C, chromosome 16 at 96,056,173 bp
  • T to A, chromosome 17 at 23,346,397 bp
  • T to C, chromosome 17 at 28,594,218 bp
  • T to C, chromosome 19 at 9,004,822 bp
  • A to G, chromosome 19 at 10,917,916 bp
  • T to C, chromosome 19 at 39,689,137 bp
  • G to A, chromosome Y at 914,044 bp
  • T to C, chromosome Y at 10,323,226 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7483 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045557-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.