Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7483Btlr/Mmmh
Stock Number:
045557-MU
Citation ID:
RRID:MMRRC_045557-MU
Other Names:
R7483 (G1)
Major Collection:

Strain Information

Chrna7
Name: cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms: Acra7, alpha7, alpha7 nicotinic receptor, alpha7-nAChR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11441
Homologene: 593
Ash2l
Name: ASH2 like histone lysine methyltransferase complex subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23808
HGNC: HGNC:744
Homologene: 3436
Srpk1
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20815
Homologene: 110962
Hdac11
Name: histone deacetylase 11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232232
Homologene: 11743
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Usp38
Name: ubiquitin specific peptidase 38
Synonyms: 4631402N15Rik, 4833420O05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74841
Homologene: 12367
Jpt1
Name: Jupiter microtubule associated homolog 1
Synonyms: Hn1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15374
Homologene: 7364
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 46,175,419 bp
  • T to C, chromosome 1 at 80,515,566 bp
  • G to T, chromosome 1 at 131,976,811 bp
  • T to A, chromosome 1 at 162,657,109 bp
  • A to G, chromosome 2 at 6,027,408 bp
  • A to T, chromosome 2 at 24,404,756 bp
  • A to G, chromosome 2 at 66,533,348 bp
  • A to T, chromosome 2 at 76,951,512 bp
  • T to C, chromosome 2 at 111,983,779 bp
  • A to G, chromosome 2 at 134,639,661 bp
  • T to C, chromosome 2 at 156,098,218 bp
  • A to G, chromosome 3 at 5,412,177 bp
  • C to T, chromosome 3 at 95,007,530 bp
  • A to G, chromosome 3 at 109,159,435 bp
  • T to C, chromosome 4 at 6,393,089 bp
  • A to G, chromosome 4 at 11,610,372 bp
  • A to G, chromosome 4 at 41,117,424 bp
  • G to T, chromosome 4 at 115,923,711 bp
  • A to G, chromosome 4 at 118,410,979 bp
  • A to G, chromosome 4 at 118,830,320 bp
  • C to T, chromosome 4 at 126,073,933 bp
  • A to T, chromosome 4 at 134,218,241 bp
  • A to G, chromosome 4 at 141,219,842 bp
  • A to T, chromosome 5 at 14,712,592 bp
  • A to G, chromosome 5 at 87,424,114 bp
  • A to G, chromosome 5 at 88,501,820 bp
  • A to G, chromosome 5 at 90,299,996 bp
  • T to A, chromosome 5 at 102,841,308 bp
  • A to T, chromosome 5 at 121,656,012 bp
  • A to T, chromosome 5 at 123,617,384 bp
  • T to A, chromosome 5 at 123,864,798 bp
  • A to T, chromosome 5 at 137,446,795 bp
  • T to TCCG, chromosome 6 at 4,756,451 bp
  • T to C, chromosome 6 at 39,627,838 bp
  • C to A, chromosome 6 at 52,164,299 bp
  • C to T, chromosome 6 at 91,159,232 bp
  • C to T, chromosome 6 at 138,416,502 bp
  • C to T, chromosome 7 at 12,670,828 bp
  • T to C, chromosome 7 at 15,397,316 bp
  • T to G, chromosome 7 at 28,277,818 bp
  • C to A, chromosome 7 at 63,104,990 bp
  • T to C, chromosome 7 at 81,282,833 bp
  • G to T, chromosome 7 at 82,867,906 bp
  • T to G, chromosome 7 at 83,998,576 bp
  • T to A, chromosome 7 at 98,063,674 bp
  • T to A, chromosome 7 at 98,449,757 bp
  • T to A, chromosome 7 at 107,106,775 bp
  • T to C, chromosome 7 at 141,639,823 bp
  • G to T, chromosome 8 at 25,822,770 bp
  • A to G, chromosome 8 at 39,071,481 bp
  • A to G, chromosome 8 at 45,023,160 bp
  • C to T, chromosome 8 at 81,014,561 bp
  • A to T, chromosome 8 at 104,549,584 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 23,483,942 bp
  • C to T, chromosome 9 at 31,414,032 bp
  • C to A, chromosome 9 at 50,770,151 bp
  • T to G, chromosome 10 at 4,353,967 bp
  • A to T, chromosome 10 at 80,495,476 bp
  • A to G, chromosome 10 at 116,283,429 bp
  • A to T, chromosome 10 at 128,268,767 bp
  • T to C, chromosome 11 at 5,521,098 bp
  • A to T, chromosome 11 at 23,021,006 bp
  • A to G, chromosome 11 at 86,215,618 bp
  • A to T, chromosome 11 at 87,761,525 bp
  • A to G, chromosome 11 at 105,109,286 bp
  • T to C, chromosome 11 at 115,503,124 bp
  • A to T, chromosome 11 at 115,858,744 bp
  • T to C, chromosome 12 at 32,195,648 bp
  • T to C, chromosome 12 at 89,510,462 bp
  • A to G, chromosome 13 at 23,099,568 bp
  • A to G, chromosome 13 at 67,256,914 bp
  • T to A, chromosome 13 at 95,027,743 bp
  • T to A, chromosome 14 at 50,534,015 bp
  • A to T, chromosome 14 at 60,008,375 bp
  • A to C, chromosome 14 at 78,982,234 bp
  • T to C, chromosome 14 at 96,346,868 bp
  • A to G, chromosome 14 at 123,314,087 bp
  • T to A, chromosome 15 at 9,002,132 bp
  • T to A, chromosome 15 at 44,229,231 bp
  • A to G, chromosome 15 at 44,405,857 bp
  • A to T, chromosome 15 at 58,641,945 bp
  • C to A, chromosome 15 at 85,537,414 bp
  • A to G, chromosome 15 at 99,991,778 bp
  • A to G, chromosome 16 at 15,630,442 bp
  • T to C, chromosome 16 at 96,056,173 bp
  • T to A, chromosome 17 at 23,346,397 bp
  • T to C, chromosome 17 at 28,594,218 bp
  • T to C, chromosome 19 at 9,004,822 bp
  • A to G, chromosome 19 at 10,917,916 bp
  • T to C, chromosome 19 at 39,689,137 bp
  • G to A, chromosome Y at 914,044 bp
  • T to C, chromosome Y at 10,323,226 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7483 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045557-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.