Strain Name:
C57BL/6J-MtgxR7486Btlr/Mmmh
Stock Number:
045560-MU
Citation ID:
RRID:MMRRC_045560-MU
Other Names:
R7486 (G1)
Major Collection:

Strain Information

Dnajc3
Name: DnaJ heat shock protein family (Hsp40) member C3
Synonyms: Dnajc3a, p58IPK, Dnajc3, Dnajc3b, mp58, Prkri
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100037258
VEGA: 14
HGNC: HGNC:9439
Homologene: 2486
Cnnm2
Name: cyclin M2
Synonyms: Acdp2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 94219
VEGA: 19
HGNC: HGNC:103
Homologene: 9761
Lamb1
Name: laminin B1
Synonyms: Lamb-1, D130003D08Rik, C80098, Lamb1-1, C81607
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Kcnmb4
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms: 2900045G12Rik, Slowpoke beta 4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58802
HGNC: HGNC:6289
Homologene: 8721
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, Acf7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Scrib
Name: scribbled planar cell polarity
Synonyms: Crc, Scrb1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: Smc2l1, CAP-E, Fin16, 5730502P04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14211
Homologene: 4705
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, Phr1, C130061D10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, Trap240L, 6330591G05Rik, 9030618F05Rik, Thrap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: Ltpr7, 2310022G15Rik, LTRPC7, 5033407O22Rik, TRP-PLIK, CHAK, CHAK1, 4833414K03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58800
Homologene: 9774
Pcnt
Name: pericentrin (kendrin)
Synonyms: m239Asp, Pcnt2, m275Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lec1, Lphn2, Lphh1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Katnb1
Name: katanin p80 (WD40-containing) subunit B 1
Synonyms: 2410003J24Rik, KAT
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74187
HGNC: HGNC:6217
Homologene: 4302
Trim24
Name: tripartite motif-containing 24
Synonyms: Tif1a, A130082H20Rik, D430004I05Rik, TIF1alpha
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21848
Homologene: 20830
Cep68
Name: centrosomal protein 68
Synonyms: 6030463E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216543
Homologene: 65235
Cacul1
Name: CDK2 associated, cullin domain 1
Synonyms: 2700078E11Rik, D130033C15Rik, 9830127L17Rik, 2810417M16Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78832
VEGA: 19
Homologene: 17821
Unc13d
Name: unc-13 homolog D
Synonyms: Jinx, 2610108D09Rik, Munc13-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195018
Homologene: 9027
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Ssg1, DRO1, Urb, 2610001E17Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67896
Homologene: 12206
Fam114a2
Name: family with sequence similarity 114, member A2
Synonyms: 9030624B09Rik, 1810073G14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67726
HGNC: HGNC:1333
Homologene: 10270
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: Crpd, CRP-[a], ebnerin, hensin, MUCLIN, gp300, vomeroglandin, CRP-[b]
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: B430107L16Rik, Rab6ip2, RAB6IP2A, Elks1, RAB6IP2B, 5033405M01Rik, 9630025C19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 111173
Homologene: 14229
Tcf20
Name: transcription factor 20
Synonyms: 2810438H08Rik, SPBP, stromelysin 1 PDGF responsive element binding protein
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21411
VEGA: 15
Homologene: 4131
Ppp6r1
Name: protein phosphatase 6, regulatory subunit 1
Synonyms: B430201G11Rik, Pp6r1, Saps1, 2010309P17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243819
Homologene: 86982
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: A930031B09Rik, D330024H06Rik, Ankrd15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107351
Homologene: 17706
Zbtb2
Name: zinc finger and BTB domain containing 2
Synonyms: LOC381990
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 381990
VEGA: 10
Homologene: 10837
Rasa3
Name: RAS p21 protein activator 3
Synonyms: R-Ras gap, scat, GAPIII activator 3, GAPIII, Ras GTPase-activating protein III, hlb381
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19414
Homologene: 7217
Pcdh20
Name: protocadherin 20
Synonyms: C630015B17Rik, PCDH13
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219257
Homologene: 11277
Adgre5
Name: adhesion G protein-coupled receptor E5
Synonyms: Cd97, EGF-TM7 receptor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26364
Homologene: 8050
Myo19
Name: myosin XIX
Synonyms: Myohd1, 1110055A02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66196
Homologene: 49819
Nipbl
Name: NIPBL cohesin loading factor
Synonyms: 4921518A06Rik, 4933421G18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71175
VEGA: 15
Homologene: 15850
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 5430439G14Rik, 6330406J24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Zfp653
Name: zinc finger protein 653
Synonyms: E430039K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319601
VEGA: 9
Homologene: 16346
Robo4
Name: roundabout guidance receptor 4
Synonyms: Magic roundabout, 1200012D01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Insm1
Name: insulinoma-associated 1
Synonyms: IA-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53626
HGNC: HGNC:6090
Homologene: 31080
Ercc5
Name: excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms: Xpg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22592
HGNC: HGNC:3437
Homologene: 133551
Ppm1m
Name: protein phosphatase 1M
Synonyms: PP2C eta, 2810423O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67905
Homologene: 44900
Setd1b
Name: SET domain containing 1B
Synonyms: KMT2G
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208043
Homologene: 134654
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Oog3
Name: oogenesin 3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100012
Homologene: 129883
Cpne8
Name: copine VIII
Synonyms: 1500031E20Rik, 1200003E11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66871
Homologene: 12049
Clca3a2
Name: chloride channel accessory 3A2
Synonyms: Clca2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80797
HGNC: HGNC:2017
Homologene: 77224
Chmp6
Name: charged multivesicular body protein 6
Synonyms: chromatin modifying protein 6, 2400004G01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 208092
Homologene: 11607
Nox3
Name: NADPH oxidase 3
Synonyms: het, nmf250
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224480
HGNC: HGNC:7890
Homologene: 49435
Vmn2r25
Name: vomeronasal 2, receptor 25
Synonyms: EG545874
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 545874
Homologene: 135915
Slc25a45
Name: solute carrier family 25, member 45
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107375
Homologene: 76679
Tie1
Name: tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Synonyms: tie-1, D430008P04Rik, TIE
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21846
Homologene: 3957
Or1e29
Name: olfactory receptor family 1 subfamily E member 29
Synonyms: Olfr389, GA_x6K02T2P1NL-3932085-3931147, MOR135-6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259011
Homologene: 85925
Nt5dc1
Name: 5'-nucleotidase domain containing 1
Synonyms: 6030401B09Rik, Nt5c2l1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319638
Homologene: 16281
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Map7d1
Name: MAP7 domain containing 1
Synonyms: Parcc1, Mtap7d1, Rprc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 245877
Homologene: 17009
Tesc
Name: tescalcin
Synonyms: 2410011K10Rik, 1010001A17Rik, TE-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57816
Homologene: 75158
Ano8
Name: anoctamin 8
Synonyms: Tmem16h
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382014
Homologene: 124473
Frk
Name: fyn-related kinase
Synonyms: GTK, BSK/IYK
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14302
VEGA: 10
HGNC: HGNC:3955
Homologene: 48065
Adam21
Name: a disintegrin and metallopeptidase domain 21
Synonyms: ADAM31
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56622
HGNC: HGNC:200
Homologene: 68365
Mcm8
Name: minichromosome maintenance 8 homologous recombination repair factor
Synonyms: 5730432L01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66634
Homologene: 12001
Cfap221
Name: cilia and flagella associated protein 221
Synonyms: Pcdp1, Gm101
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226356
Homologene: 88578
Pgghg
Name: protein glucosylgalactosylhydroxylysine glucosidase
Synonyms: 5730511L01Rik, Athl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212974
Homologene: 16023
Akp3
Name: alkaline phosphatase 3, intestine, not Mn requiring
Synonyms: IAP, Akp-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11648
Homologene: 134333
Eef2k
Name: eukaryotic elongation factor-2 kinase
Synonyms: eEF-2K
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13631
Homologene: 7299
Krtap9-21
Name: keratin associated protein 9-21
Synonyms: Gm11568
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432600
Prss41
Name: serine protease 41
Synonyms: 4931440B09Rik, Tessp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71003
Homologene: 28091
Mstn
Name: myostatin
Synonyms: Gdf8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17700
HGNC: HGNC:4223
Homologene: 3850
Zfp865
Name: zinc finger protein 865
Synonyms: 6430526N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319748
Homologene: 19652
Nkd2
Name: naked cuticle 2
Synonyms: 2210403L10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72293
Homologene: 12459
Gpr153
Name: G protein-coupled receptor 153
Synonyms: PGR1, 1110065N12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100129
Homologene: 18662
Or12j4
Name: olfactory receptor family 12 subfamily J member 4
Synonyms: MOR252-3P, GA_x6K02T2PBJ9-42615403-42616365, Olfr533
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258056
Homologene: 128384
Blvra
Name: biliverdin reductase A
Synonyms: Blvr, 2500001N03Rik, 0610006A11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109778
HGNC: HGNC:1062
Homologene: 572
Gpt2
Name: glutamic pyruvate transaminase (alanine aminotransferase) 2
Synonyms: 4631422C05Rik, ALT2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108682
Homologene: 68832
Upk3a
Name: uroplakin 3A
Synonyms: 1110017C07Rik, Upk3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22270
VEGA: 15
Homologene: 5066
Or10g9
Name: olfactory receptor family 10 subfamily G member 9
Synonyms: MOR223-1, GA_x6K02T2PVTD-33699706-33698771, Olfr979
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259112
VEGA: 9
Homologene: 81556
Wipf1
Name: WAS/WASL interacting protein family, member 1
Synonyms: Waspip, WIP, D2Ertd120e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215280
Homologene: 86891
Hsfy2
Name: heat shock transcription factor, Y-linked 2
Synonyms: 4933413G11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71066
Homologene: 134090
Slc14a1
Name: solute carrier family 14 (urea transporter), member 1
Synonyms: UT-B, 3021401A05Rik, 2610507K20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108052
Homologene: 9285
Gsg1
Name: germ cell associated 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14840
Homologene: 7745
Larp7-ps
Name: La ribonucleoprotein 7, transcriptional regulator, pseudogene
Synonyms: Gm12666
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68280
Dpm3
Name: dolichyl-phosphate mannosyltransferase polypeptide 3
Synonyms: 1110001H19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68563
HGNC: HGNC:3007
Homologene: 17810
Spo11
Name: SPO11 initiator of meiotic double stranded breaks
Synonyms: Spo11b, Spo11a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26972
Homologene: 6059
Pcdhga2
Name: protocadherin gamma subfamily A, 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93710
HGNC: HGNC:8700
Homologene: 69262
Pcdha12
Name: protocadherin alpha 12
Synonyms: Cnr5, Crnr5, Pcdha13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192164
HGNC: HGNC:8667
Homologene: 135870
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 44,148,064 bp
  • G to A, chromosome 1 at 46,290,734 bp
  • G to T, chromosome 1 at 53,063,969 bp
  • G to A, chromosome 1 at 56,636,971 bp
  • A to G, chromosome 1 at 87,125,479 bp
  • A to T, chromosome 1 at 119,923,592 bp
  • GCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCC, chromosome 2 at 73,440,074 bp
  • A to G, chromosome 2 at 126,831,195 bp
  • T to C, chromosome 2 at 127,087,323 bp
  • C to T, chromosome 2 at 132,839,520 bp
  • G to A, chromosome 2 at 146,223,818 bp
  • A to G, chromosome 2 at 160,950,003 bp
  • G to A, chromosome 2 at 172,984,077 bp
  • C to A, chromosome 3 at 38,957,427 bp
  • A to G, chromosome 3 at 89,266,727 bp
  • T to A, chromosome 3 at 144,797,601 bp
  • A to G, chromosome 3 at 148,817,694 bp
  • A to T, chromosome 4 at 52,462,861 bp
  • A to T, chromosome 4 at 92,191,269 bp
  • C to A, chromosome 4 at 118,479,904 bp
  • T to G, chromosome 4 at 123,409,581 bp
  • C to A, chromosome 4 at 126,234,386 bp
  • T to A, chromosome 4 at 144,158,172 bp
  • A to G, chromosome 4 at 152,282,401 bp
  • T to A, chromosome 5 at 118,046,317 bp
  • C to T, chromosome 5 at 118,728,474 bp
  • A to G, chromosome 5 at 123,163,592 bp
  • T to G, chromosome 6 at 37,957,839 bp
  • G to A, chromosome 6 at 119,594,946 bp
  • T to C, chromosome 6 at 123,823,142 bp
  • C to T, chromosome 6 at 135,237,429 bp
  • A to G, chromosome 7 at 4,639,900 bp
  • A to G, chromosome 7 at 5,031,260 bp
  • T to C, chromosome 7 at 49,917,330 bp
  • A to G, chromosome 7 at 120,858,570 bp
  • T to G, chromosome 7 at 131,066,462 bp
  • C to T, chromosome 7 at 140,466,034 bp
  • T to A, chromosome 7 at 140,942,480 bp
  • C to T, chromosome 8 at 13,590,201 bp
  • A to G, chromosome 8 at 71,484,998 bp
  • T to C, chromosome 8 at 83,723,886 bp
  • T to C, chromosome 8 at 85,525,606 bp
  • T to A, chromosome 8 at 95,098,729 bp
  • T to C, chromosome 9 at 22,056,528 bp
  • T to C, chromosome 9 at 37,405,574 bp
  • T to A, chromosome 9 at 40,000,885 bp
  • T to C, chromosome 9 at 106,196,611 bp
  • G to A, chromosome 10 at 4,369,025 bp
  • A to G, chromosome 10 at 34,399,809 bp
  • G to A, chromosome 10 at 34,547,296 bp
  • G to T, chromosome 10 at 76,418,436 bp
  • T to C, chromosome 10 at 76,418,437 bp
  • A to G, chromosome 10 at 107,821,988 bp
  • A to G, chromosome 10 at 116,418,275 bp
  • T to C, chromosome 11 at 20,242,166 bp
  • C to T, chromosome 11 at 57,513,689 bp
  • T to C, chromosome 11 at 72,864,786 bp
  • T to C, chromosome 11 at 73,777,021 bp
  • T to C, chromosome 11 at 84,905,637 bp
  • T to A, chromosome 11 at 99,858,466 bp
  • T to C, chromosome 11 at 116,074,433 bp
  • T to C, chromosome 11 at 119,916,957 bp
  • T to G, chromosome 12 at 31,287,442 bp
  • T to C, chromosome 12 at 81,558,883 bp
  • T to A, chromosome 13 at 73,847,442 bp
  • T to A, chromosome 14 at 88,468,614 bp
  • C to T, chromosome 14 at 103,197,254 bp
  • C to A, chromosome 14 at 118,972,404 bp
  • A to T, chromosome 15 at 8,295,636 bp
  • A to G, chromosome 15 at 76,057,650 bp
  • A to T, chromosome 15 at 82,853,734 bp
  • A to T, chromosome 15 at 85,018,024 bp
  • A to T, chromosome 15 at 90,515,906 bp
  • T to C, chromosome 16 at 45,126,179 bp
  • T to A, chromosome 17 at 3,669,944 bp
  • ACAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCA, chromosome 17 at 23,844,098 bp
  • T to A, chromosome 18 at 37,021,557 bp
  • A to G, chromosome 18 at 37,670,408 bp
  • T to C, chromosome 18 at 78,111,524 bp
  • A to G, chromosome 19 at 5,884,969 bp
  • G to A, chromosome 19 at 25,410,829 bp
  • T to C, chromosome 19 at 46,762,074 bp
  • T to A, chromosome 19 at 60,580,430 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7486 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045560-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.