Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7486Btlr/Mmmh
Stock Number:
045560-MU
Citation ID:
RRID:MMRRC_045560-MU
Other Names:
R7486 (G1)
Major Collection:

Strain Information

Dnajc3
Name: DnaJ heat shock protein family (Hsp40) member C3
Synonyms: p58IPK, mp58, Prkri, Dnajc3, Dnajc3a, Dnajc3b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100037258
VEGA: 14
HGNC: HGNC:9439
Homologene: 2486
Cnnm2
Name: cyclin M2
Synonyms: Acdp2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 94219
VEGA: 19
HGNC: HGNC:103
Homologene: 9761
Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Kcnmb4
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms: Slowpoke beta 4, 2900045G12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58802
HGNC: HGNC:6289
Homologene: 8721
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 44,148,064 bp
  • G to A, chromosome 1 at 46,290,734 bp
  • G to T, chromosome 1 at 53,063,969 bp
  • G to A, chromosome 1 at 56,636,971 bp
  • A to G, chromosome 1 at 87,125,479 bp
  • A to T, chromosome 1 at 119,923,592 bp
  • GCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCC, chromosome 2 at 73,440,074 bp
  • A to G, chromosome 2 at 126,831,195 bp
  • T to C, chromosome 2 at 127,087,323 bp
  • C to T, chromosome 2 at 132,839,520 bp
  • G to A, chromosome 2 at 146,223,818 bp
  • A to G, chromosome 2 at 160,950,003 bp
  • G to A, chromosome 2 at 172,984,077 bp
  • C to A, chromosome 3 at 38,957,427 bp
  • A to G, chromosome 3 at 89,266,727 bp
  • T to A, chromosome 3 at 144,797,601 bp
  • A to G, chromosome 3 at 148,817,694 bp
  • A to T, chromosome 4 at 52,462,861 bp
  • A to T, chromosome 4 at 92,191,269 bp
  • C to A, chromosome 4 at 118,479,904 bp
  • T to G, chromosome 4 at 123,409,581 bp
  • C to A, chromosome 4 at 126,234,386 bp
  • T to A, chromosome 4 at 144,158,172 bp
  • A to G, chromosome 4 at 152,282,401 bp
  • T to A, chromosome 5 at 118,046,317 bp
  • C to T, chromosome 5 at 118,728,474 bp
  • A to G, chromosome 5 at 123,163,592 bp
  • T to G, chromosome 6 at 37,957,839 bp
  • G to A, chromosome 6 at 119,594,946 bp
  • T to C, chromosome 6 at 123,823,142 bp
  • C to T, chromosome 6 at 135,237,429 bp
  • A to G, chromosome 7 at 4,639,900 bp
  • A to G, chromosome 7 at 5,031,260 bp
  • T to C, chromosome 7 at 49,917,330 bp
  • A to G, chromosome 7 at 120,858,570 bp
  • T to G, chromosome 7 at 131,066,462 bp
  • C to T, chromosome 7 at 140,466,034 bp
  • T to A, chromosome 7 at 140,942,480 bp
  • C to T, chromosome 8 at 13,590,201 bp
  • A to G, chromosome 8 at 71,484,998 bp
  • T to C, chromosome 8 at 83,723,886 bp
  • T to C, chromosome 8 at 85,525,606 bp
  • T to A, chromosome 8 at 95,098,729 bp
  • T to C, chromosome 9 at 22,056,528 bp
  • T to C, chromosome 9 at 37,405,574 bp
  • T to A, chromosome 9 at 40,000,885 bp
  • T to C, chromosome 9 at 106,196,611 bp
  • G to A, chromosome 10 at 4,369,025 bp
  • A to G, chromosome 10 at 34,399,809 bp
  • G to A, chromosome 10 at 34,547,296 bp
  • G to T, chromosome 10 at 76,418,436 bp
  • T to C, chromosome 10 at 76,418,437 bp
  • A to G, chromosome 10 at 107,821,988 bp
  • A to G, chromosome 10 at 116,418,275 bp
  • T to C, chromosome 11 at 20,242,166 bp
  • C to T, chromosome 11 at 57,513,689 bp
  • T to C, chromosome 11 at 72,864,786 bp
  • T to C, chromosome 11 at 73,777,021 bp
  • T to C, chromosome 11 at 84,905,637 bp
  • T to A, chromosome 11 at 99,858,466 bp
  • T to C, chromosome 11 at 116,074,433 bp
  • T to C, chromosome 11 at 119,916,957 bp
  • T to G, chromosome 12 at 31,287,442 bp
  • T to C, chromosome 12 at 81,558,883 bp
  • T to A, chromosome 13 at 73,847,442 bp
  • T to A, chromosome 14 at 88,468,614 bp
  • C to T, chromosome 14 at 103,197,254 bp
  • C to A, chromosome 14 at 118,972,404 bp
  • A to T, chromosome 15 at 8,295,636 bp
  • A to G, chromosome 15 at 76,057,650 bp
  • A to T, chromosome 15 at 82,853,734 bp
  • A to T, chromosome 15 at 85,018,024 bp
  • A to T, chromosome 15 at 90,515,906 bp
  • T to C, chromosome 16 at 45,126,179 bp
  • T to A, chromosome 17 at 3,669,944 bp
  • ACAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCA, chromosome 17 at 23,844,098 bp
  • T to A, chromosome 18 at 37,021,557 bp
  • A to G, chromosome 18 at 37,670,408 bp
  • T to C, chromosome 18 at 78,111,524 bp
  • A to G, chromosome 19 at 5,884,969 bp
  • G to A, chromosome 19 at 25,410,829 bp
  • T to C, chromosome 19 at 46,762,074 bp
  • T to A, chromosome 19 at 60,580,430 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7486 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045560-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.