Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7544Btlr/Mmmh
Stock Number:
045616-MU
Citation ID:
RRID:MMRRC_045616-MU
Other Names:
R7544 (G1)
Major Collection:

Strain Information

Nr2f2
Name: nuclear receptor subfamily 2, group F, member 2
Synonyms: COUP-TFII, ARP-1, Tcfcoup2, Aporp1, COUP-TF2, 9430015G03Rik, EAR3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11819
HGNC: HGNC:7976
Homologene: 7628
Fzd9
Name: frizzled class receptor 9
Synonyms: mfz9, frizzled 9, Fz9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14371
HGNC: HGNC:4047
Homologene: 2619
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Ppp1r1a
Name: protein phosphatase 1, regulatory inhibitor subunit 1A
Synonyms: I-1, protein phosphatase inhibitor-1, inhibitor-1, 0610038N18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 58200
VEGA: 15
HGNC: HGNC:9286
Homologene: 4905
Ptpn12
Name: protein tyrosine phosphatase, non-receptor type 12
Synonyms: P19-PTP, PTP-PEST, PTP-P19
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19248
HGNC: HGNC:9645
Homologene: 37691
Paip1
Name: polyadenylate binding protein-interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218693
Homologene: 4709
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: 5730409A01Rik, 1810061H24Rik, SAP130, RSE1, D8Ertd633e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101943
Homologene: 6579
Trip13
Name: thyroid hormone receptor interactor 13
Synonyms: 2410002G23Rik, D13Ertd328e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69716
Homologene: 3125
Diaph1
Name: diaphanous related formin 1
Synonyms: p140mDia, Drf1, Dia1, D18Wsu154e, mDia1, Diap1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13367
HGNC: HGNC:2876
Homologene: 129567
Gnai3
Name: G protein subunit alpha i3
Synonyms: Galphai3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14679
HGNC: HGNC:4387
Homologene: 55975
Tom1l2
Name: target of myb1-like 2 (chicken)
Synonyms: 2900016I08Rik, myb1-like protein 2, A730055F12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216810
Homologene: 44901
Atxn2
Name: ataxin 2
Synonyms: ATX2, 9630045M23Rik, Sca2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20239
Homologene: 2234
Mars1
Name: methionine-tRNA synthetase 1
Synonyms: MetRS, methionine tRNA ligase, methionyl-tRNA synthetase, Mars
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216443
HGNC: HGNC:6898
Homologene: 90878
Lin54
Name: lin-54 DREAM MuvB core complex component
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231506
Homologene: 18212
Bicc1
Name: BicC family RNA binding protein 1
Synonyms: Bic-C, jcpk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83675
Homologene: 12856
Lef1
Name: lymphoid enhancer binding factor 1
Synonyms: lymphoid enhancer factor 1, Lef-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16842
HGNC: HGNC:6551
Homologene: 7813
Fbf1
Name: Fas binding factor 1
Synonyms: 1110033G01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217335
Homologene: 16531
Flvcr1
Name: feline leukemia virus subgroup C cellular receptor 1
Synonyms: 9630055N22Rik, Mfsd7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226844
Homologene: 56661
Usp39
Name: ubiquitin specific peptidase 39
Synonyms: D6Wsu157e, CGI-21, SAD1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28035
Homologene: 13183
Slmap
Name: sarcolemma associated protein
Synonyms: Slap, D330001L02Rik, Miranda
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 83997
Homologene: 31428
Ddx11
Name: DEAD/H box helicase 11
Synonyms: CHLR1, KRG2, CHL1, 4732462I11Rik, essa15a, DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320209
VEGA: 17
Homologene: 68973
Grin1
Name: glutamate receptor, ionotropic, NMDA1 (zeta 1)
Synonyms: NMDAR1, NR1, Nmdar, M100174, GluRzeta1, Rgsc174
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14810
HGNC: HGNC:4584
Homologene: 7187
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Tdo2
Name: tryptophan 2,3-dioxygenase
Synonyms: TDO, TO, chky
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56720
Homologene: 4132
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Ern2
Name: endoplasmic reticulum to nucleus signalling 2
Synonyms: Ire1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26918
Homologene: 22687
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Tet3
Name: tet methylcytosine dioxygenase 3
Synonyms: D230004J03Rik, B430006D22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194388
Homologene: 35360
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Trak2
Name: trafficking protein, kinesin binding 2
Synonyms: GRIF-1, CALS-C, OIP98, GRIF1, 4733401O11Rik, Als2cr3, 2900022D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70827
Homologene: 22861
Trappc11
Name: trafficking protein particle complex 11
Synonyms: D030016E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320714
Homologene: 11076
Capn7
Name: calpain 7
Synonyms: PalBH
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12339
HGNC: HGNC:1484
Homologene: 7651
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Kcnh4
Name: potassium voltage-gated channel, subfamily H (eag-related), member 4
Synonyms: BEC2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380728
HGNC: HGNC:6253
Homologene: 8180
Nckap5
Name: NCK-associated protein 5
Synonyms: LOC380609, D130011D22Rik, E030049G20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210356
Homologene: 35542
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: LOC380730, Gm884
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380730
Homologene: 134511
Prkcg
Name: protein kinase C, gamma
Synonyms: PKCgamma, Pkcc, Prkcc
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18752
HGNC: HGNC:9402
Homologene: 20602
Urah
Name: urate (5-hydroxyiso-) hydrolase
Synonyms: 2810420C16Rik, HIU hydrolase, 1190003J15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76974
Homologene: 45975
Cfap69
Name: cilia and flagella associated protein 69
Synonyms: A330021E22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207686
Homologene: 11718
Slc5a3
Name: solute carrier family 5 (inositol transporters), member 3
Synonyms: Smit1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 53881
Homologene: 31412
Gtf3c5
Name: general transcription factor IIIC, polypeptide 5
Synonyms: TFiiiC2-63, TFIIICepsilon, TFIIIC63, 2700084A09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70239
HGNC: HGNC:4668
Homologene: 40806
Trp63
Name: transformation related protein 63
Synonyms: KET protein, p63, p73L, Trp53rp1, TAp63, p51/p63, deltaNp63
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22061
Homologene: 31189
Prpf40b
Name: pre-mRNA processing factor 40B
Synonyms: 2610317D23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54614
Homologene: 81828
4933427D14Rik
Name: RIKEN cDNA 4933427D14 gene
Synonyms: Gm43951
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74477
Homologene: 8874
Lrrc4b
Name: leucine rich repeat containing 4B
Synonyms: Lrig4, NGL-3, Ngl3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 272381
Homologene: 45681
Zfp85
Name: zinc finger protein 85
Synonyms: Zfp71, KRAB19, Zfp85-rs1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22746
Homologene: 133709
Trim62
Name: tripartite motif-containing 62
Synonyms: 6330414G21Rik, Dear1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67525
Homologene: 10071
Npas1
Name: neuronal PAS domain protein 1
Synonyms: MOP5, bHLHe11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18142
HGNC: HGNC:7894
Homologene: 1886
Elovl4
Name: ELOVL fatty acid elongase 4
Synonyms: elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83603
Homologene: 41488
Gpc5
Name: glypican 5
Synonyms: A230034F01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 103978
HGNC: HGNC:4453
Homologene: 3285
Pidd1
Name: p53 induced death domain protein 1
Synonyms: 1200011D09Rik, Pidd, Lrdd
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57913
Homologene: 11220
Pgpep1
Name: pyroglutamyl-peptidase I
Synonyms: PGP-I, Pcp, 2810003H13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66522
Homologene: 9793
Tmem151a
Name: transmembrane protein 151A
Synonyms: LOC381199, Tmem151, Gm30627
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381199
Homologene: 17721
Klra9
Name: killer cell lectin-like receptor subfamily A, member 9
Synonyms: Ly49I, LY49I1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16640
Homologene: 110821
Or1e19
Name: olfactory receptor family 1 subfamily E member 19
Synonyms: GA_x6K02T2P1NL-3586282-3585338, MOR135-2, Olfr378
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259026
Homologene: 74110
Or10a3b
Name: olfactory receptor family 10 subfamily A member 3B
Synonyms: GA_x6K02T2PBJ9-11176324-11175380, MOR268-2, Olfr516
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258720
Homologene: 138316
Ndst1
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonyms: glucosaminyl N-deacetylase/N-sulfotransferase 1, Hsst, 1200015G06Rik, Ndst-1, b2b2230Clo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15531
VEGA: 18
HGNC: HGNC:7680
Homologene: 20386
Pramel18
Name: PRAME like 18
Synonyms: Gm12800
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381535
Cyp4a14
Name: cytochrome P450, family 4, subfamily a, polypeptide 14
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13119
Homologene: 134697
Psg17
Name: pregnancy specific beta-1-glycoprotein 17
Synonyms: mmCGM5, Cea-2, Cea2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26437
Homologene: 110989
Kcnk12
Name: potassium channel, subfamily K, member 12
Synonyms: mntk1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210741
VEGA: 17
HGNC: HGNC:6274
Homologene: 11107
Or4p8
Name: olfactory receptor family 4 subfamily P member 8
Synonyms: GA_x6K02T2Q125-50372411-50371485, MOR225-4, Olfr1208
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258774
Homologene: 74190
Wfikkn2
Name: WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Synonyms: Gasp1, 2610304F08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 278507
Homologene: 35284
Ech1
Name: enoyl coenzyme A hydratase 1, peroxisomal
Synonyms: dienoyl-CoA isomerase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 51798
HGNC: HGNC:3149
Homologene: 1069
Mpnd
Name: MPN domain containing
Synonyms: E130307M08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68047
Homologene: 12231
Mad2l1bp
Name: MAD2L1 binding protein
Synonyms: 0610009D16Rik, CMT2B, CMT2A, 2510031P20Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66591
VEGA: 17
Homologene: 11990
Tcp10c
Name: t-complex protein 10c
Synonyms: T66C-a, D17Leh66ca, D17Leh66C, Tcp-10c, Gm9880
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100041352
VEGA: 17
Homologene: 83254
Pcdha4
Name: protocadherin alpha 4
Synonyms: Cnr1, Crnr1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12936
HGNC: HGNC:8670
Homologene: 130626
Bnip5
Name: BCL2 interacting protein 5
Synonyms: 4930539E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 207819
Homologene: 52098
Pramel51
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 58,921,068 bp
  • A to T, chromosome 1 at 60,769,700 bp
  • A to G, chromosome 1 at 126,026,211 bp
  • C to A, chromosome 1 at 191,025,946 bp
  • T to C, chromosome 2 at 25,305,074 bp
  • T to A, chromosome 2 at 28,579,542 bp
  • T to C, chromosome 2 at 69,265,486 bp
  • T to A, chromosome 2 at 88,897,361 bp
  • T to G, chromosome 3 at 5,412,815 bp
  • A to G, chromosome 3 at 81,971,635 bp
  • T to C, chromosome 3 at 83,355,127 bp
  • C to T, chromosome 3 at 108,118,386 bp
  • T to A, chromosome 3 at 131,194,765 bp
  • T to C, chromosome 4 at 101,911,402 bp
  • T to A, chromosome 4 at 115,491,086 bp
  • C to T, chromosome 4 at 128,902,553 bp
  • G to A, chromosome 5 at 5,595,936 bp
  • A to G, chromosome 5 at 21,009,511 bp
  • T to A, chromosome 5 at 21,976,278 bp
  • A to G, chromosome 5 at 73,081,039 bp
  • A to G, chromosome 5 at 100,485,270 bp
  • T to C, chromosome 5 at 121,781,368 bp
  • A to G, chromosome 5 at 135,249,862 bp
  • TCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATC to T, chromosome 6 at 4,756,427 bp
  • G to A, chromosome 6 at 72,342,908 bp
  • A to T, chromosome 6 at 83,404,641 bp
  • T to G, chromosome 6 at 130,191,220 bp
  • A to G, chromosome 7 at 3,310,565 bp
  • A to T, chromosome 7 at 16,460,974 bp
  • A to G, chromosome 7 at 18,819,972 bp
  • T to C, chromosome 7 at 28,825,967 bp
  • A to T, chromosome 7 at 44,462,551 bp
  • A to T, chromosome 7 at 70,354,751 bp
  • A to G, chromosome 7 at 108,845,321 bp
  • G to A, chromosome 7 at 122,173,199 bp
  • A to T, chromosome 7 at 140,835,652 bp
  • T to A, chromosome 7 at 141,440,339 bp
  • T to C, chromosome 8 at 14,979,854 bp
  • T to C, chromosome 8 at 16,092,296 bp
  • T to A, chromosome 8 at 47,522,414 bp
  • C to T, chromosome 8 at 70,650,518 bp
  • A to T, chromosome 8 at 110,589,525 bp
  • T to C, chromosome 8 at 110,838,283 bp
  • T to C, chromosome 9 at 83,783,218 bp
  • T to C, chromosome 10 at 70,956,374 bp
  • T to C, chromosome 10 at 127,311,610 bp
  • TTGATGATG to TTGATG, chromosome 11 at 60,280,214 bp
  • C to T, chromosome 11 at 72,198,939 bp
  • A to G, chromosome 11 at 73,425,770 bp
  • T to C, chromosome 11 at 94,237,912 bp
  • G to T, chromosome 11 at 100,757,080 bp
  • T to C, chromosome 11 at 103,615,448 bp
  • A to T, chromosome 11 at 116,165,833 bp
  • T to A, chromosome 12 at 88,176,080 bp
  • C to T, chromosome 13 at 67,749,065 bp
  • T to C, chromosome 13 at 73,932,902 bp
  • T to A, chromosome 13 at 119,445,801 bp
  • T to A, chromosome 14 at 26,429,846 bp
  • C to T, chromosome 14 at 26,429,848 bp
  • T to G, chromosome 14 at 31,340,050 bp
  • T to C, chromosome 14 at 115,428,173 bp
  • A to G, chromosome 15 at 99,306,018 bp
  • C to T, chromosome 15 at 103,531,349 bp
  • A to G, chromosome 16 at 25,802,087 bp
  • T to A, chromosome 16 at 32,736,198 bp
  • T to A, chromosome 16 at 92,077,794 bp
  • T to A, chromosome 17 at 13,360,998 bp
  • G to A, chromosome 17 at 28,905,324 bp
  • A to G, chromosome 17 at 46,152,844 bp
  • G to A, chromosome 17 at 56,011,666 bp
  • G to A, chromosome 17 at 66,126,285 bp
  • A to T, chromosome 17 at 87,746,065 bp
  • A to T, chromosome 18 at 36,953,723 bp
  • A to T, chromosome 18 at 37,893,269 bp
  • G to A, chromosome 18 at 60,697,184 bp
  • T to A, chromosome 19 at 5,071,867 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7544 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045616-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.