Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7544Btlr/Mmmh
Stock Number:
045616-MU
Citation ID:
RRID:MMRRC_045616-MU
Other Names:
R7544 (G1)
Major Collection:

Strain Information

Nr2f2
Name: nuclear receptor subfamily 2, group F, member 2
Synonyms: COUP-TFII, ARP-1, Tcfcoup2, Aporp1, COUP-TF2, 9430015G03Rik, EAR3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11819
HGNC: HGNC:7976
Homologene: 7628
Fzd9
Name: frizzled class receptor 9
Synonyms: mfz9, frizzled 9, Fz9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14371
HGNC: HGNC:4047
Homologene: 2619
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Ppp1r1a
Name: protein phosphatase 1, regulatory inhibitor subunit 1A
Synonyms: I-1, protein phosphatase inhibitor-1, inhibitor-1, 0610038N18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 58200
VEGA: 15
HGNC: HGNC:9286
Homologene: 4905
Ptpn12
Name: protein tyrosine phosphatase, non-receptor type 12
Synonyms: P19-PTP, PTP-PEST, PTP-P19
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19248
HGNC: HGNC:9645
Homologene: 37691
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 58,921,068 bp
  • A to T, chromosome 1 at 60,769,700 bp
  • A to G, chromosome 1 at 126,026,211 bp
  • C to A, chromosome 1 at 191,025,946 bp
  • T to C, chromosome 2 at 25,305,074 bp
  • T to A, chromosome 2 at 28,579,542 bp
  • T to C, chromosome 2 at 69,265,486 bp
  • T to A, chromosome 2 at 88,897,361 bp
  • T to G, chromosome 3 at 5,412,815 bp
  • A to G, chromosome 3 at 81,971,635 bp
  • T to C, chromosome 3 at 83,355,127 bp
  • C to T, chromosome 3 at 108,118,386 bp
  • T to A, chromosome 3 at 131,194,765 bp
  • T to C, chromosome 4 at 101,911,402 bp
  • T to A, chromosome 4 at 115,491,086 bp
  • C to T, chromosome 4 at 128,902,553 bp
  • G to A, chromosome 5 at 5,595,936 bp
  • A to G, chromosome 5 at 21,009,511 bp
  • T to A, chromosome 5 at 21,976,278 bp
  • A to G, chromosome 5 at 73,081,039 bp
  • A to G, chromosome 5 at 100,485,270 bp
  • T to C, chromosome 5 at 121,781,368 bp
  • A to G, chromosome 5 at 135,249,862 bp
  • TCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATC to T, chromosome 6 at 4,756,427 bp
  • G to A, chromosome 6 at 72,342,908 bp
  • A to T, chromosome 6 at 83,404,641 bp
  • T to G, chromosome 6 at 130,191,220 bp
  • A to G, chromosome 7 at 3,310,565 bp
  • A to T, chromosome 7 at 16,460,974 bp
  • A to G, chromosome 7 at 18,819,972 bp
  • T to C, chromosome 7 at 28,825,967 bp
  • A to T, chromosome 7 at 44,462,551 bp
  • A to T, chromosome 7 at 70,354,751 bp
  • A to G, chromosome 7 at 108,845,321 bp
  • G to A, chromosome 7 at 122,173,199 bp
  • A to T, chromosome 7 at 140,835,652 bp
  • T to A, chromosome 7 at 141,440,339 bp
  • T to C, chromosome 8 at 14,979,854 bp
  • T to C, chromosome 8 at 16,092,296 bp
  • T to A, chromosome 8 at 47,522,414 bp
  • C to T, chromosome 8 at 70,650,518 bp
  • A to T, chromosome 8 at 110,589,525 bp
  • T to C, chromosome 8 at 110,838,283 bp
  • T to C, chromosome 9 at 83,783,218 bp
  • T to C, chromosome 10 at 70,956,374 bp
  • T to C, chromosome 10 at 127,311,610 bp
  • TTGATGATG to TTGATG, chromosome 11 at 60,280,214 bp
  • C to T, chromosome 11 at 72,198,939 bp
  • A to G, chromosome 11 at 73,425,770 bp
  • T to C, chromosome 11 at 94,237,912 bp
  • G to T, chromosome 11 at 100,757,080 bp
  • T to C, chromosome 11 at 103,615,448 bp
  • A to T, chromosome 11 at 116,165,833 bp
  • T to A, chromosome 12 at 88,176,080 bp
  • C to T, chromosome 13 at 67,749,065 bp
  • T to C, chromosome 13 at 73,932,902 bp
  • T to A, chromosome 13 at 119,445,801 bp
  • T to A, chromosome 14 at 26,429,846 bp
  • C to T, chromosome 14 at 26,429,848 bp
  • T to G, chromosome 14 at 31,340,050 bp
  • T to C, chromosome 14 at 115,428,173 bp
  • A to G, chromosome 15 at 99,306,018 bp
  • C to T, chromosome 15 at 103,531,349 bp
  • A to G, chromosome 16 at 25,802,087 bp
  • T to A, chromosome 16 at 32,736,198 bp
  • T to A, chromosome 16 at 92,077,794 bp
  • T to A, chromosome 17 at 13,360,998 bp
  • G to A, chromosome 17 at 28,905,324 bp
  • A to G, chromosome 17 at 46,152,844 bp
  • G to A, chromosome 17 at 56,011,666 bp
  • G to A, chromosome 17 at 66,126,285 bp
  • A to T, chromosome 17 at 87,746,065 bp
  • A to T, chromosome 18 at 36,953,723 bp
  • A to T, chromosome 18 at 37,893,269 bp
  • G to A, chromosome 18 at 60,697,184 bp
  • T to A, chromosome 19 at 5,071,867 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7544 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045616-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.