Strain Name:
C57BL/6J-MtgxR7575Btlr/Mmmh
Stock Number:
045632-MU
Citation ID:
RRID:MMRRC_045632-MU
Other Names:
R7575 (G1)
Major Collection:

Strain Information

Pitx2
Name: paired-like homeodomain transcription factor 2
Synonyms: Otlx2, Brx1b, Brx1a, Brx1, solurshin, Ptx2, Munc30, Pitx2c, Pitx2b, Pitx2a, Rieg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18741
HGNC: HGNC:9005
Homologene: 55454
Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Ccr2
Name: C-C motif chemokine receptor 2
Synonyms: CC-CKR-2, CKR2B, CKR2A, CCR2B, CCR2A, CKR2, Cmkbr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12772
HGNC: HGNC:1603
Homologene: 537
Rasgrp2
Name: RAS, guanyl releasing protein 2
Synonyms: CalDAG-GEFI, Caldaggef1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19395
HGNC: HGNC:9879
Homologene: 4250
Oxr1
Name: oxidation resistance 1
Synonyms: C7B, C7, 2210416C20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Arhgef18
Name: Rho/Rac guanine nucleotide exchange factor 18
Synonyms: D030053O22Rik, A430078G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102098
Homologene: 32254
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54447
VEGA: 19
Homologene: 10310
Zc3h7b
Name: zinc finger CCCH type containing 7B
Synonyms: Scrg3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20286
VEGA: 15
Homologene: 9735
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Ago1
Name: argonaute RISC catalytic subunit 1
Synonyms: argonaute 1, Eif2c1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236511
HGNC: HGNC:3262
Homologene: 81826
Iqgap2
Name: IQ motif containing GTPase activating protein 2
Synonyms: 4933417J23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544963
VEGA: 13
HGNC: HGNC:6111
Homologene: 101543
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Inppl1
Name: inositol polyphosphate phosphatase-like 1
Synonyms: SHIP2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16332
HGNC: HGNC:6080
Homologene: 1204
Git2
Name: GIT ArfGAP 2
Synonyms: Cool associated tyrosine phosphorylated-2, Cat-2, ARF GTPase activating protein 2, 5830420E16Rik, B230104M05Rik, 1500036H07Rik, 9630056M03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26431
HGNC: HGNC:4273
Homologene: 41336
Parp4
Name: poly (ADP-ribose) polymerase family, member 4
Synonyms: VPARP, VAULT3, p193, PH5P, E230037B21Rik, Adprtl1, C030027K23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328417
HGNC: HGNC:271
Homologene: 124423
Slc19a2
Name: solute carrier family 19 (thiamine transporter), member 2
Synonyms: DDA1, TRMA, THTR1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116914
Homologene: 38258
Uhrf2
Name: ubiquitin-like, containing PHD and RING finger domains 2
Synonyms: D130071B19Rik, 2310065A22Rik, Nirf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109113
Homologene: 17001
Wipi2
Name: WD repeat domain, phosphoinositide interacting 2
Synonyms: 2510001I10Rik, 1110018O08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74781
Homologene: 90887
Thbs1
Name: thrombospondin 1
Synonyms: TSP1, tbsp1, Thbs-1, TSP-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21825
Homologene: 31142
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: RAB6IP2B, RAB6IP2A, 5033405M01Rik, B430107L16Rik, 9630025C19Rik, Rab6ip2, Elks1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 111173
Homologene: 14229
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Zbtb14
Name: zinc finger and BTB domain containing 14
Synonyms: b2b1982Clo, Zfp161, ZF5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22666
Homologene: 2560
Drd3
Name: dopamine receptor D3
Synonyms: D3R, D3 receptor
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13490
VEGA: 16
HGNC: HGNC:3024
Homologene: 623
Rasa3
Name: RAS p21 protein activator 3
Synonyms: GAPIII activator 3, Ras GTPase-activating protein III, GAPIII, R-Ras gap, scat, hlb381
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19414
Homologene: 7217
Adam18
Name: a disintegrin and metallopeptidase domain 18
Synonyms: Adam27, Dtgn3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13524
HGNC: HGNC:196
Homologene: 74941
Alb
Name: albumin
Synonyms: Alb-1, Alb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11657
HGNC: HGNC:399
Homologene: 405
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Mtr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase
Synonyms: methionine synthase, MS, D830038K18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238505
VEGA: 13
HGNC: HGNC:7468
Homologene: 37280
Bub1b
Name: BUB1B, mitotic checkpoint serine/threonine kinase
Synonyms: BUBR1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12236
HGNC: HGNC:1149
Homologene: 933
Slamf7
Name: SLAM family member 7
Synonyms: 19A24, novel Ly9, CS1, 19A, 4930560D03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75345
Homologene: 49660
Tmem107
Name: transmembrane protein 107
Synonyms: 1110004B13Rik, 2810049P21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66910
Homologene: 12052
Adarb1
Name: adenosine deaminase, RNA-specific, B1
Synonyms: RED1, ADAR2, D10Bwg0447e, 1700057H01Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110532
HGNC: HGNC:226
Homologene: 8280
Camk1
Name: calcium/calmodulin-dependent protein kinase I
Synonyms: D6Ertd263e, CaMKIalpha, Camk
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52163
HGNC: HGNC:1459
Homologene: 117458
Ghr
Name: growth hormone receptor
Synonyms: GHBP, GHR/BP
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14600
HGNC: HGNC:4263
Homologene: 134
Adamtsl3
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269959
Homologene: 18912
Spata31
Name: spermatogenesis associated 31
Synonyms: Fam75a, 4930458L03Rik, Spata31a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78124
Homologene: 84621
Stradb
Name: STE20-related kinase adaptor beta
Synonyms: D1Ucla2, Als2cr2, PRO1038
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227154
Homologene: 10237
Ush2a
Name: usherin
Synonyms: Ushrn, A930037M10Rik, MUSH2A, LOC269160, A930011D15Rik, LOC381317, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Zhx2
Name: zinc fingers and homeoboxes 2
Synonyms: Afr1, Afr-1, Raf
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 387609
Homologene: 8968
Or9i1
Name: olfactory receptor family 9 subfamily I member 1
Synonyms: GA_x6K02T2RE5P-4193992-4194942, MOR211-1, Olfr1502
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258793
Homologene: 17394
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Usp40
Name: ubiquitin specific peptidase 40
Synonyms: B230215L03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227334
Homologene: 32400
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Gdpd4
Name: glycerophosphodiester phosphodiesterase domain containing 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233537
Homologene: 18606
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Ubqlnl
Name: ubiquilin-like
Synonyms: 4922504M18Rik, LOC244179
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244179
Homologene: 17034
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Pappa2
Name: pappalysin 2
Synonyms: placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
Tmem216
Name: transmembrane protein 216
Synonyms: 4921533J23Rik, A930021F15Rik, 1110017C22Rik, 2810441K11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68642
Homologene: 9541
Tpte
Name: transmembrane phosphatase with tensin homology
Synonyms: Pten2, Vsp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234129
Homologene: 50411
Prdm9
Name: PR domain containing 9
Synonyms: Meisetz, G1-419-29, repro7, Dsbc1, Rcr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213389
Homologene: 104139
Tbc1d4
Name: TBC1 domain family, member 4
Synonyms: AS160, 5930406J04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210789
Homologene: 45451
Idua
Name: iduronidase, alpha-L
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15932
HGNC: HGNC:5391
Homologene: 170
Or8j3c
Name: olfactory receptor family 8 subfamily J member 3C
Synonyms: GA_x6K02T2Q125-47892992-47892045, MOR185-1, Olfr1062
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259082
Homologene: 83135
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Trim54
Name: tripartite motif-containing 54
Synonyms: MuRF3, Rnf30, 4930486E09Rik, 4930566I02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 58522
Homologene: 10983
Jmy
Name: junction-mediating and regulatory protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 57748
VEGA: 13
Homologene: 10955
Fam170b
Name: family with sequence similarity 170, member B
Synonyms: 4922501K12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105511
VEGA: 14
Homologene: 19055
Mtmr10
Name: myotubularin related protein 10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233315
Homologene: 9822
Vmn1r121
Name: vomeronasal 1 receptor 121
Synonyms: Gm8533
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667240
Homologene: 104166
Cdh18
Name: cadherin 18
Synonyms: B230220E17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320865
HGNC: HGNC:1757
Homologene: 55858
Gbp10
Name: guanylate-binding protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 626578
Homologene: 128731
Pcare
Name: photoreceptor cilium actin regulator
Synonyms: BC027072
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225004
VEGA: 17
Homologene: 19792
Vmn2r101
Name: vomeronasal 2, receptor 101
Synonyms: EG627576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627576
Homologene: 115024
Atpsckmt
Name: ATP synthase C subunit lysine N-methyltransferase
Synonyms: A930016P21Rik, Fam173b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68073
Homologene: 16780
Or4k44
Name: olfactory receptor family 4 subfamily K member 44
Synonyms: GA_x6K02T2Q125-72589785-72588847, MOR248-7, Olfr1294
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258887
Homologene: 74216
4921539E11Rik
Name: RIKEN cDNA 4921539E11 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70941
Homologene: 52843
Vmn1r203
Name: vomeronasal 1 receptor 203
Synonyms: V1rh11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171270
Homologene: 110880
Papss1
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 1
Synonyms: SK1, Asapk
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23971
HGNC: HGNC:8603
Homologene: 81740
Cyp2j8
Name: cytochrome P450, family 2, subfamily j, polypeptide 8
Synonyms: OTTMUSG00000007938, Cyp2j8-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665095
HGNC: HGNC:2634
Homologene: 133819
Ipp
Name: IAP promoted placental gene
Synonyms: D4Jhu8, Mipp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16351
HGNC: HGNC:6108
Homologene: 4309
Or6c68
Name: olfactory receptor family 6 subfamily C member 68
Synonyms: GA_x6K02T2PULF-11002360-11003298, MOR114-12, Olfr780
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258281
Homologene: 133586
Tas2r134
Name: taste receptor, type 2, member 134
Synonyms: T2R134, Tas2r34
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 387511
Homologene: 66001
Bud23
Name: BUD23, rRNA methyltransferase and ribosome maturation factor
Synonyms: 1110003N24Rik, Wbscr22
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66138
Homologene: 5486
Dusp7
Name: dual specificity phosphatase 7
Synonyms: PYST2, MKP-X
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235584
HGNC: HGNC:3073
Homologene: 1468
Cyp11b1
Name: cytochrome P450, family 11, subfamily b, polypeptide 1
Synonyms: Cyp11b-1, Cyp11b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110115
Homologene: 106948
Preb
Name: prolactin regulatory element binding
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50907
HGNC: HGNC:9356
Homologene: 40877
Mogs
Name: mannosyl-oligosaccharide glucosidase
Synonyms: 1810017N02Rik, Gcs1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57377
Homologene: 4593
Sdc1
Name: syndecan 1
Synonyms: CD138, Synd1, Synd, syn-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20969
Homologene: 2252
Fzd4
Name: frizzled class receptor 4
Synonyms: Fz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14366
HGNC: HGNC:4042
Homologene: 7325
Try5
Name: trypsin 5
Synonyms: 1810049H19Rik, Tc
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 103964
Homologene: 106639
Bbc3
Name: BCL2 binding component 3
Synonyms: PUMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170770
Homologene: 8679
C1d
Name: C1D nuclear receptor co-repressor
Synonyms: SUN-CoR, 1110036E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57316
Homologene: 4619
Gfy
Name: golgi-associated olfactory signaling regulator
Synonyms: Gm581, Goofy
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100039953
Homologene: 85248
Sprr2b
Name: small proline-rich protein 2B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20756
Wdr49
Name: WD repeat domain 49
Synonyms: EG213248
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213248
Homologene: 18714
Cys1
Name: cystin 1
Synonyms: ck, 2900006B19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12879
Homologene: 84604
Eppk1
Name: epiplakin 1
Synonyms: EPIPL1, EPPK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223650
VEGA: 15
Homologene: 20006
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,988,580 bp
  • A to C, chromosome 1 at 87,949,960 bp
  • A to G, chromosome 1 at 90,810,599 bp
  • A to T, chromosome 1 at 158,814,530 bp
  • T to C, chromosome 1 at 164,257,122 bp
  • A to C, chromosome 1 at 171,639,194 bp
  • A to T, chromosome 1 at 188,822,688 bp
  • A to G, chromosome 2 at 51,628,154 bp
  • A to G, chromosome 2 at 86,423,238 bp
  • A to T, chromosome 2 at 111,538,252 bp
  • A to G, chromosome 2 at 118,122,928 bp
  • T to A, chromosome 2 at 118,641,158 bp
  • A to T, chromosome 3 at 75,450,886 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • A to T, chromosome 3 at 129,215,726 bp
  • A to C, chromosome 3 at 131,643,096 bp
  • A to G, chromosome 4 at 96,470,548 bp
  • T to C, chromosome 4 at 103,230,995 bp
  • T to C, chromosome 4 at 116,532,644 bp
  • T to C, chromosome 4 at 126,453,908 bp
  • A to T, chromosome 5 at 30,958,495 bp
  • G to A, chromosome 5 at 31,134,087 bp
  • A to G, chromosome 5 at 34,905,643 bp
  • G to A, chromosome 5 at 90,465,929 bp
  • A to T, chromosome 5 at 96,543,314 bp
  • G to A, chromosome 5 at 105,236,149 bp
  • A to T, chromosome 5 at 108,681,699 bp
  • C to T, chromosome 5 at 114,766,489 bp
  • A to T, chromosome 5 at 135,061,128 bp
  • A to G, chromosome 5 at 142,658,232 bp
  • A to T, chromosome 6 at 41,311,814 bp
  • T to G, chromosome 6 at 83,115,835 bp
  • T to A, chromosome 6 at 85,622,159 bp
  • T to A, chromosome 6 at 113,338,364 bp
  • G to T, chromosome 6 at 119,824,760 bp
  • G to A, chromosome 7 at 16,312,367 bp
  • T to A, chromosome 7 at 21,098,273 bp
  • A to G, chromosome 7 at 45,178,100 bp
  • A to T, chromosome 7 at 64,297,465 bp
  • A to T, chromosome 7 at 82,574,548 bp
  • A to G, chromosome 7 at 89,407,710 bp
  • A to T, chromosome 7 at 97,998,241 bp
  • G to A, chromosome 7 at 101,828,482 bp
  • G to A, chromosome 7 at 104,148,490 bp
  • T to G, chromosome 8 at 3,451,635 bp
  • A to T, chromosome 8 at 13,595,887 bp
  • A to G, chromosome 8 at 22,355,482 bp
  • T to C, chromosome 8 at 24,625,857 bp
  • T to C, chromosome 9 at 106,373,677 bp
  • A to C, chromosome 9 at 124,105,806 bp
  • A to G, chromosome 10 at 39,821,445 bp
  • A to T, chromosome 10 at 76,389,252 bp
  • A to G, chromosome 10 at 77,303,295 bp
  • T to C, chromosome 10 at 129,321,859 bp
  • A to G, chromosome 11 at 17,262,694 bp
  • A to G, chromosome 11 at 62,383,256 bp
  • C to T, chromosome 11 at 69,072,807 bp
  • G to T, chromosome 11 at 120,812,687 bp
  • A to G, chromosome 12 at 8,790,619 bp
  • T to A, chromosome 12 at 24,668,648 bp
  • A to G, chromosome 13 at 9,628,012 bp
  • T to C, chromosome 13 at 12,199,077 bp
  • C to A, chromosome 13 at 22,524,418 bp
  • C to T, chromosome 13 at 64,922,912 bp
  • A to T, chromosome 13 at 93,464,595 bp
  • A to G, chromosome 13 at 95,661,623 bp
  • C to T, chromosome 14 at 32,662,632 bp
  • C to T, chromosome 14 at 32,836,198 bp
  • T to C, chromosome 14 at 56,637,918 bp
  • T to C, chromosome 14 at 101,447,589 bp
  • A to T, chromosome 15 at 3,320,512 bp
  • A to T, chromosome 15 at 4,934,605 bp
  • G to T, chromosome 15 at 23,400,597 bp
  • C to T, chromosome 15 at 31,606,040 bp
  • T to G, chromosome 15 at 41,823,362 bp
  • T to A, chromosome 15 at 57,823,262 bp
  • T to A, chromosome 15 at 74,839,313 bp
  • A to G, chromosome 15 at 76,111,242 bp
  • C to A, chromosome 15 at 81,777,885 bp
  • CTGCTGCTG to CTGCTGCTGATGCTGCTG, chromosome 15 at 98,849,611 bp
  • C to A, chromosome 16 at 37,091,134 bp
  • A to T, chromosome 16 at 43,817,133 bp
  • C to T, chromosome 17 at 15,544,628 bp
  • T to C, chromosome 17 at 19,611,392 bp
  • C to T, chromosome 17 at 32,154,819 bp
  • T to C, chromosome 17 at 69,387,447 bp
  • T to A, chromosome 17 at 71,750,855 bp
  • T to A, chromosome 19 at 6,404,367 bp
  • A to T, chromosome 19 at 10,551,902 bp
  • T to C, chromosome 19 at 13,862,017 bp
  • C to A, chromosome 19 at 30,071,368 bp
  • T to C, chromosome 19 at 32,016,703 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7575 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045632-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.