Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7575Btlr/Mmmh
Stock Number:
045632-MU
Citation ID:
RRID:MMRRC_045632-MU
Other Names:
R7575 (G1)
Major Collection:

Strain Information

Pitx2
Name: paired-like homeodomain transcription factor 2
Synonyms: Otlx2, Brx1b, Brx1a, Brx1, solurshin, Ptx2, Munc30, Pitx2c, Pitx2b, Pitx2a, Rieg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18741
HGNC: HGNC:9005
Homologene: 55454
Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Ccr2
Name: C-C motif chemokine receptor 2
Synonyms: CC-CKR-2, CKR2B, CKR2A, CCR2B, CCR2A, CKR2, Cmkbr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12772
HGNC: HGNC:1603
Homologene: 537
Rasgrp2
Name: RAS, guanyl releasing protein 2
Synonyms: CalDAG-GEFI, Caldaggef1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19395
HGNC: HGNC:9879
Homologene: 4250
Oxr1
Name: oxidation resistance 1
Synonyms: C7B, C7, 2210416C20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,988,580 bp
  • A to C, chromosome 1 at 87,949,960 bp
  • A to G, chromosome 1 at 90,810,599 bp
  • A to T, chromosome 1 at 158,814,530 bp
  • T to C, chromosome 1 at 164,257,122 bp
  • A to C, chromosome 1 at 171,639,194 bp
  • A to T, chromosome 1 at 188,822,688 bp
  • A to G, chromosome 2 at 51,628,154 bp
  • A to G, chromosome 2 at 86,423,238 bp
  • A to T, chromosome 2 at 111,538,252 bp
  • A to G, chromosome 2 at 118,122,928 bp
  • T to A, chromosome 2 at 118,641,158 bp
  • A to T, chromosome 3 at 75,450,886 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • A to T, chromosome 3 at 129,215,726 bp
  • A to C, chromosome 3 at 131,643,096 bp
  • A to G, chromosome 4 at 96,470,548 bp
  • T to C, chromosome 4 at 103,230,995 bp
  • T to C, chromosome 4 at 116,532,644 bp
  • T to C, chromosome 4 at 126,453,908 bp
  • A to T, chromosome 5 at 30,958,495 bp
  • G to A, chromosome 5 at 31,134,087 bp
  • A to G, chromosome 5 at 34,905,643 bp
  • G to A, chromosome 5 at 90,465,929 bp
  • A to T, chromosome 5 at 96,543,314 bp
  • G to A, chromosome 5 at 105,236,149 bp
  • A to T, chromosome 5 at 108,681,699 bp
  • C to T, chromosome 5 at 114,766,489 bp
  • A to T, chromosome 5 at 135,061,128 bp
  • A to G, chromosome 5 at 142,658,232 bp
  • A to T, chromosome 6 at 41,311,814 bp
  • T to G, chromosome 6 at 83,115,835 bp
  • T to A, chromosome 6 at 85,622,159 bp
  • T to A, chromosome 6 at 113,338,364 bp
  • G to T, chromosome 6 at 119,824,760 bp
  • G to A, chromosome 7 at 16,312,367 bp
  • T to A, chromosome 7 at 21,098,273 bp
  • A to G, chromosome 7 at 45,178,100 bp
  • A to T, chromosome 7 at 64,297,465 bp
  • A to T, chromosome 7 at 82,574,548 bp
  • A to G, chromosome 7 at 89,407,710 bp
  • A to T, chromosome 7 at 97,998,241 bp
  • G to A, chromosome 7 at 101,828,482 bp
  • G to A, chromosome 7 at 104,148,490 bp
  • T to G, chromosome 8 at 3,451,635 bp
  • A to T, chromosome 8 at 13,595,887 bp
  • A to G, chromosome 8 at 22,355,482 bp
  • T to C, chromosome 8 at 24,625,857 bp
  • T to C, chromosome 9 at 106,373,677 bp
  • A to C, chromosome 9 at 124,105,806 bp
  • A to G, chromosome 10 at 39,821,445 bp
  • A to T, chromosome 10 at 76,389,252 bp
  • A to G, chromosome 10 at 77,303,295 bp
  • T to C, chromosome 10 at 129,321,859 bp
  • A to G, chromosome 11 at 17,262,694 bp
  • A to G, chromosome 11 at 62,383,256 bp
  • C to T, chromosome 11 at 69,072,807 bp
  • G to T, chromosome 11 at 120,812,687 bp
  • A to G, chromosome 12 at 8,790,619 bp
  • T to A, chromosome 12 at 24,668,648 bp
  • A to G, chromosome 13 at 9,628,012 bp
  • T to C, chromosome 13 at 12,199,077 bp
  • C to A, chromosome 13 at 22,524,418 bp
  • C to T, chromosome 13 at 64,922,912 bp
  • A to T, chromosome 13 at 93,464,595 bp
  • A to G, chromosome 13 at 95,661,623 bp
  • C to T, chromosome 14 at 32,662,632 bp
  • C to T, chromosome 14 at 32,836,198 bp
  • T to C, chromosome 14 at 56,637,918 bp
  • T to C, chromosome 14 at 101,447,589 bp
  • A to T, chromosome 15 at 3,320,512 bp
  • A to T, chromosome 15 at 4,934,605 bp
  • G to T, chromosome 15 at 23,400,597 bp
  • C to T, chromosome 15 at 31,606,040 bp
  • T to G, chromosome 15 at 41,823,362 bp
  • T to A, chromosome 15 at 57,823,262 bp
  • T to A, chromosome 15 at 74,839,313 bp
  • A to G, chromosome 15 at 76,111,242 bp
  • C to A, chromosome 15 at 81,777,885 bp
  • CTGCTGCTG to CTGCTGCTGATGCTGCTG, chromosome 15 at 98,849,611 bp
  • C to A, chromosome 16 at 37,091,134 bp
  • A to T, chromosome 16 at 43,817,133 bp
  • C to T, chromosome 17 at 15,544,628 bp
  • T to C, chromosome 17 at 19,611,392 bp
  • C to T, chromosome 17 at 32,154,819 bp
  • T to C, chromosome 17 at 69,387,447 bp
  • T to A, chromosome 17 at 71,750,855 bp
  • T to A, chromosome 19 at 6,404,367 bp
  • A to T, chromosome 19 at 10,551,902 bp
  • T to C, chromosome 19 at 13,862,017 bp
  • C to A, chromosome 19 at 30,071,368 bp
  • T to C, chromosome 19 at 32,016,703 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7575 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045632-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.