Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7650Btlr/Mmmh
Stock Number:
045727-MU
Citation ID:
RRID:MMRRC_045727-MU
Other Names:
R7650 (G1)
Major Collection:

Strain Information

Shh
Name: sonic hedgehog
Synonyms: Hhg1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20423
Homologene: 30961
Fezf2
Name: Fez family zinc finger 2
Synonyms: forebrain embryonic zinc finger, Fez, Fezl, Zfp312
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54713
VEGA: 14
Homologene: 9957
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 11,149,854 bp
  • A to T, chromosome 1 at 131,021,455 bp
  • A to G, chromosome 2 at 10,092,168 bp
  • T to C, chromosome 2 at 91,628,396 bp
  • T to C, chromosome 2 at 131,061,147 bp
  • A to T, chromosome 2 at 152,486,103 bp
  • C to T, chromosome 2 at 154,354,116 bp
  • T to C, chromosome 2 at 164,049,590 bp
  • G to A, chromosome 3 at 90,268,749 bp
  • A to T, chromosome 3 at 97,699,107 bp
  • A to G, chromosome 3 at 138,466,367 bp
  • A to G, chromosome 3 at 145,314,453 bp
  • C to T, chromosome 5 at 21,834,330 bp
  • G to T, chromosome 5 at 23,760,246 bp
  • C to A, chromosome 5 at 28,458,306 bp
  • A to G, chromosome 5 at 87,080,972 bp
  • A to G, chromosome 5 at 108,584,295 bp
  • T to G, chromosome 5 at 125,787,010 bp
  • A to G, chromosome 5 at 137,045,533 bp
  • A to G, chromosome 5 at 150,413,418 bp
  • T to A, chromosome 6 at 38,395,040 bp
  • T to A, chromosome 6 at 88,618,548 bp
  • T to A, chromosome 6 at 124,861,843 bp
  • C to T, chromosome 6 at 146,233,994 bp
  • T to C, chromosome 7 at 16,906,951 bp
  • C to A, chromosome 7 at 18,726,759 bp
  • C to A, chromosome 7 at 19,244,971 bp
  • G to A, chromosome 7 at 30,699,789 bp
  • C to A, chromosome 7 at 37,569,692 bp
  • T to A, chromosome 7 at 75,643,454 bp
  • T to A, chromosome 7 at 85,871,939 bp
  • T to C, chromosome 7 at 88,430,429 bp
  • C to T, chromosome 7 at 92,858,935 bp
  • T to A, chromosome 7 at 102,428,827 bp
  • G to A, chromosome 7 at 141,082,370 bp
  • A to G, chromosome 7 at 141,809,422 bp
  • T to A, chromosome 8 at 71,390,924 bp
  • T to C, chromosome 8 at 109,672,585 bp
  • A to T, chromosome 8 at 123,268,564 bp
  • T to A, chromosome 8 at 128,498,014 bp
  • G to A, chromosome 9 at 21,580,372 bp
  • A to G, chromosome 9 at 37,661,405 bp
  • A to T, chromosome 9 at 39,771,873 bp
  • A to T, chromosome 9 at 44,933,436 bp
  • T to A, chromosome 9 at 97,363,148 bp
  • A to G, chromosome 9 at 106,838,344 bp
  • G to A, chromosome 10 at 14,716,424 bp
  • C to T, chromosome 10 at 52,046,209 bp
  • T to C, chromosome 10 at 80,835,763 bp
  • A to T, chromosome 11 at 50,383,899 bp
  • A to G, chromosome 11 at 50,883,753 bp
  • G to A, chromosome 11 at 51,234,786 bp
  • G to A, chromosome 11 at 53,437,098 bp
  • A to G, chromosome 11 at 59,060,994 bp
  • A to T, chromosome 11 at 70,970,445 bp
  • G to T, chromosome 11 at 80,601,684 bp
  • T to C, chromosome 12 at 17,362,682 bp
  • T to C, chromosome 12 at 44,547,322 bp
  • A to G, chromosome 13 at 52,611,095 bp
  • A to G, chromosome 13 at 70,589,797 bp
  • T to A, chromosome 13 at 70,605,483 bp
  • T to C, chromosome 14 at 6,055,211 bp
  • T to C, chromosome 14 at 12,342,653 bp
  • G to A, chromosome 14 at 14,773,348 bp
  • T to A, chromosome 14 at 20,995,046 bp
  • T to C, chromosome 14 at 96,346,943 bp
  • A to G, chromosome 15 at 81,793,650 bp
  • C to T, chromosome 15 at 93,245,658 bp
  • C to T, chromosome 15 at 98,850,870 bp
  • A to G, chromosome 15 at 99,939,907 bp
  • G to A, chromosome 15 at 102,004,163 bp
  • A to T, chromosome 16 at 55,817,839 bp
  • T to A, chromosome 16 at 58,926,053 bp
  • A to T, chromosome 17 at 21,928,837 bp
  • T to C, chromosome 17 at 34,358,129 bp
  • T to A, chromosome 18 at 12,537,838 bp
  • T to A, chromosome 18 at 37,309,614 bp
  • GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA, chromosome 18 at 57,293,999 bp
  • A to T, chromosome 19 at 18,876,013 bp
  • T to A, chromosome 19 at 41,629,924 bp
  • A to G, chromosome 19 at 46,272,539 bp
  • C to A, chromosome 19 at 47,986,528 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7650 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045727-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.