Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7650Btlr/Mmmh
Stock Number:
045727-MU
Citation ID:
RRID:MMRRC_045727-MU
Other Names:
R7650 (G1)
Major Collection:

Strain Information

Shh
Name: sonic hedgehog
Synonyms: Hhg1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20423
Homologene: 30961
Fezf2
Name: Fez family zinc finger 2
Synonyms: forebrain embryonic zinc finger, Fez, Fezl, Zfp312
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54713
VEGA: 14
Homologene: 9957
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Vcl
Name: vinculin
Synonyms: metavinculin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22330
VEGA: 14
Homologene: 7594
Zc3h7b
Name: zinc finger CCCH type containing 7B
Synonyms: Scrg3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20286
VEGA: 15
Homologene: 9735
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Metap1
Name: methionyl aminopeptidase 1
Synonyms: 1700029C17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75624
Homologene: 6488
Nol10
Name: nucleolar protein 10
Synonyms: LOC217431
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217431
VEGA: 12
Homologene: 5998
Gbf1
Name: golgi-specific brefeldin A-resistance factor 1
Synonyms: 1700083E03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107338
HGNC: HGNC:4181
Homologene: 37897
Ddias
Name: DNA damage-induced apoptosis suppressor
Synonyms: noxin, 4632434I11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74041
Homologene: 51655
Opa3
Name: optic atrophy 3
Synonyms: LOC243868, LOC384570, D630048P19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 403187
HGNC: HGNC:8142
Homologene: 57022
Myo1d
Name: myosin ID
Synonyms: 9930104H07Rik, D11Ertd9e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338367
HGNC: HGNC:7598
Homologene: 45576
Ap1s1
Name: adaptor protein complex AP-1, sigma 1
Synonyms: AP19
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11769
HGNC: HGNC:559
Homologene: 20342
Adam33
Name: a disintegrin and metallopeptidase domain 33
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110751
Homologene: 11881
Stim1
Name: stromal interaction molecule 1
Synonyms: SIM
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20866
Homologene: 20681
Hnrnph1
Name: heterogeneous nuclear ribonucleoprotein H1
Synonyms: E430005G16Rik, Hnrph1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 59013
HGNC: HGNC:5041
Homologene: 31318
Carm1
Name: coactivator-associated arginine methyltransferase 1
Synonyms: Prmt4, m9Bei
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 59035
Homologene: 10990
Ice1
Name: interactor of little elongation complex ELL subunit 1
Synonyms: BC018507
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218333
VEGA: 13
Homologene: 18902
Gak
Name: cyclin G associated kinase
Synonyms: D130045N16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231580
HGNC: HGNC:4113
Homologene: 3846
Rab38
Name: RAB38, member RAS oncogene family
Synonyms: 2310011F14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72433
HGNC: HGNC:9776
Homologene: 21353
Syk
Name: spleen tyrosine kinase
Synonyms: Sykb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20963
Homologene: 2390
F2
Name: coagulation factor II
Synonyms: prothrombin, Cf-2, Cf2, FII, thrombin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14061
HGNC: HGNC:3535
Homologene: 426
Col24a1
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71355
Homologene: 65061
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Pcdhb4
Name: protocadherin beta 4
Synonyms: Pcdhb5A, PcdhbD
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93875
HGNC: HGNC:8690
Homologene: 62176
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Zfp942
Name: zinc finger protein 942
Synonyms: 3110048L19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73233
Homologene: 133237
Pus7
Name: pseudouridylate synthase 7
Synonyms: C330017I15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78697
Homologene: 6998
Ushbp1
Name: USH1 protein network component harmonin binding protein 1
Synonyms: MCC2, 2210404N08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234395
Homologene: 12914
Cfap58
Name: cilia and flagella associated protein 58
Synonyms: LOC381229, Ccdc147
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381229
VEGA: 19
Homologene: 77312
Megf10
Name: multiple EGF-like-domains 10
Synonyms: LOC240312, 3000002B06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70417
Homologene: 23771
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Gxylt1
Name: glucoside xylosyltransferase 1
Synonyms: LOC223827, LOC382997, Glt8d3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223827
Homologene: 28259
Nrp1
Name: neuropilin 1
Synonyms: Neuropilin-1, NP-1, NPN-1, Npn1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18186
HGNC: HGNC:8004
Homologene: 2876
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Pde4dip
Name: phosphodiesterase 4D interacting protein (myomegalin)
Synonyms: D3Bwg1078e, 4732458A06Rik, D130016K21Rik, 9430063L05Rik, Usmg4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83679
Homologene: 66961
Vmn2r73
Name: vomeronasal 2, receptor 73
Synonyms: EG620928
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620928
Homologene: 115466
Kin
Name: Kin17 DNA and RNA binding protein
Synonyms: Kin17, antigenic determinant of rec-A protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16588
HGNC: HGNC:6327
Homologene: 8196
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Zfp454
Name: zinc finger protein 454
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237758
Homologene: 72226
Fanca
Name: Fanconi anemia, complementation group A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14087
HGNC: HGNC:3582
Homologene: 108
Trim42
Name: tripartite motif-containing 42
Synonyms: 4930486B16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78911
Homologene: 12712
Il10
Name: interleukin 10
Synonyms: cytokine synthesis inhibitory factor, IL-10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16153
HGNC: HGNC:5962
Homologene: 478
Pkp3
Name: plakophilin 3
Synonyms: 2310056L12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56460
HGNC: HGNC:9025
Homologene: 5200
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: LOC380973, 1700030F18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Zfp536
Name: zinc finger protein 536
Synonyms: 9630010P11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243937
Homologene: 8813
Rpain
Name: RPA interacting protein
Synonyms: 2400006N03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69723
Homologene: 13006
Ube4a
Name: ubiquitination factor E4A
Synonyms: UFD2b, 9930123J21Rik, 4732444G18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 140630
Homologene: 3517
Krt8
Name: keratin 8
Synonyms: K8, EndoA, cytokeratin-8, cytokeratin8, cytokeratin 8, Krt-2.8, Card2, Krt2-8, TROMA-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16691
VEGA: 15
HGNC: HGNC:6446
Homologene: 55643
Kbtbd12
Name: kelch repeat and BTB (POZ) domain containing 12
Synonyms: 4833415F11Rik, 4933428M03Rik, Klhdc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74589
Homologene: 52613
Ift56
Name: intraflagellar transport 56
Synonyms: hpy, hydrocephalic-polydactyl, 9430097H08Rik, hop, Ttc26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 264134
Homologene: 11786
Nfkbiz
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
Synonyms: Mail
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 80859
Homologene: 12734
Pabpc1l
Name: poly(A) binding protein, cytoplasmic 1-like
Synonyms: ePAB, 1810053B01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381404
Homologene: 77989
Tmem132b
Name: transmembrane protein 132B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208151
Homologene: 28135
Psg22
Name: pregnancy-specific beta-1-glycoprotein 22
Synonyms: cea9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243862
Homologene: 110989
Btnl2
Name: butyrophilin-like 2
Synonyms: butyrophylin-like MHC class II associated, BTL-II, NG9, BTLN2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 547431
HGNC: HGNC:1142
Homologene: 10482
Or5k17
Name: olfactory receptor family 5 subfamily K member 17
Synonyms: GA_x54KRFPKG5P-55145984-55145034, MOR184-4, Olfr181
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259001
Homologene: 74112
Lingo3
Name: leucine rich repeat and Ig domain containing 3
Synonyms: LERN2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237403
VEGA: 10
Homologene: 78065
Gdf9
Name: growth differentiation factor 9
Synonyms: Gdf-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14566
HGNC: HGNC:4224
Homologene: 3851
Gje1
Name: gap junction protein, epsilon 1
Synonyms: AEY12, connexin 23, Cx23, D230044M03Rik, Gsfaey12, Gjf1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76743
Homologene: 87405
Gpr162
Name: G protein-coupled receptor 162
Synonyms: A-2, Grca
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14788
Homologene: 8400
Cdk5rap1
Name: CDK5 regulatory subunit associated protein 1
Synonyms: 2310066P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66971
Homologene: 9502
2200002J24Rik
Name: RIKEN cDNA 2200002J24 gene
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69147
Homologene: 87038
Ptgir
Name: prostaglandin I receptor (IP)
Synonyms: prostacyclin receptor, IP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19222
HGNC: HGNC:9602
Homologene: 7496
Panx3
Name: pannexin 3
Synonyms: 4833413G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208098
Homologene: 82335
Or8g53
Name: olfactory receptor family 8 subfamily G member 53
Synonyms: GA_x6K02T2PVTD-33470347-33469403, MOR171-15, Olfr968
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258605
VEGA: 9
Homologene: 121532
Msantd5
Name: Myb/SANT DNA binding domain containing 5
Synonyms: Gm12569
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 622699
Homologene: 141209
Defb22
Name: defensin beta 22
Synonyms: 9230002F21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 442835
Homologene: 83152
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 11,149,854 bp
  • A to T, chromosome 1 at 131,021,455 bp
  • A to G, chromosome 2 at 10,092,168 bp
  • T to C, chromosome 2 at 91,628,396 bp
  • T to C, chromosome 2 at 131,061,147 bp
  • A to T, chromosome 2 at 152,486,103 bp
  • C to T, chromosome 2 at 154,354,116 bp
  • T to C, chromosome 2 at 164,049,590 bp
  • G to A, chromosome 3 at 90,268,749 bp
  • A to T, chromosome 3 at 97,699,107 bp
  • A to G, chromosome 3 at 138,466,367 bp
  • A to G, chromosome 3 at 145,314,453 bp
  • C to T, chromosome 5 at 21,834,330 bp
  • G to T, chromosome 5 at 23,760,246 bp
  • C to A, chromosome 5 at 28,458,306 bp
  • A to G, chromosome 5 at 87,080,972 bp
  • A to G, chromosome 5 at 108,584,295 bp
  • T to G, chromosome 5 at 125,787,010 bp
  • A to G, chromosome 5 at 137,045,533 bp
  • A to G, chromosome 5 at 150,413,418 bp
  • T to A, chromosome 6 at 38,395,040 bp
  • T to A, chromosome 6 at 88,618,548 bp
  • T to A, chromosome 6 at 124,861,843 bp
  • C to T, chromosome 6 at 146,233,994 bp
  • T to C, chromosome 7 at 16,906,951 bp
  • C to A, chromosome 7 at 18,726,759 bp
  • C to A, chromosome 7 at 19,244,971 bp
  • G to A, chromosome 7 at 30,699,789 bp
  • C to A, chromosome 7 at 37,569,692 bp
  • T to A, chromosome 7 at 75,643,454 bp
  • T to A, chromosome 7 at 85,871,939 bp
  • T to C, chromosome 7 at 88,430,429 bp
  • C to T, chromosome 7 at 92,858,935 bp
  • T to A, chromosome 7 at 102,428,827 bp
  • G to A, chromosome 7 at 141,082,370 bp
  • A to G, chromosome 7 at 141,809,422 bp
  • T to A, chromosome 8 at 71,390,924 bp
  • T to C, chromosome 8 at 109,672,585 bp
  • A to T, chromosome 8 at 123,268,564 bp
  • T to A, chromosome 8 at 128,498,014 bp
  • G to A, chromosome 9 at 21,580,372 bp
  • A to G, chromosome 9 at 37,661,405 bp
  • A to T, chromosome 9 at 39,771,873 bp
  • A to T, chromosome 9 at 44,933,436 bp
  • T to A, chromosome 9 at 97,363,148 bp
  • A to G, chromosome 9 at 106,838,344 bp
  • G to A, chromosome 10 at 14,716,424 bp
  • C to T, chromosome 10 at 52,046,209 bp
  • T to C, chromosome 10 at 80,835,763 bp
  • A to T, chromosome 11 at 50,383,899 bp
  • A to G, chromosome 11 at 50,883,753 bp
  • G to A, chromosome 11 at 51,234,786 bp
  • G to A, chromosome 11 at 53,437,098 bp
  • A to G, chromosome 11 at 59,060,994 bp
  • A to T, chromosome 11 at 70,970,445 bp
  • G to T, chromosome 11 at 80,601,684 bp
  • T to C, chromosome 12 at 17,362,682 bp
  • T to C, chromosome 12 at 44,547,322 bp
  • A to G, chromosome 13 at 52,611,095 bp
  • A to G, chromosome 13 at 70,589,797 bp
  • T to A, chromosome 13 at 70,605,483 bp
  • T to C, chromosome 14 at 6,055,211 bp
  • T to C, chromosome 14 at 12,342,653 bp
  • G to A, chromosome 14 at 14,773,348 bp
  • T to A, chromosome 14 at 20,995,046 bp
  • T to C, chromosome 14 at 96,346,943 bp
  • A to G, chromosome 15 at 81,793,650 bp
  • C to T, chromosome 15 at 93,245,658 bp
  • C to T, chromosome 15 at 98,850,870 bp
  • A to G, chromosome 15 at 99,939,907 bp
  • G to A, chromosome 15 at 102,004,163 bp
  • A to T, chromosome 16 at 55,817,839 bp
  • T to A, chromosome 16 at 58,926,053 bp
  • A to T, chromosome 17 at 21,928,837 bp
  • T to C, chromosome 17 at 34,358,129 bp
  • T to A, chromosome 18 at 12,537,838 bp
  • T to A, chromosome 18 at 37,309,614 bp
  • GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA, chromosome 18 at 57,293,999 bp
  • A to T, chromosome 19 at 18,876,013 bp
  • T to A, chromosome 19 at 41,629,924 bp
  • A to G, chromosome 19 at 46,272,539 bp
  • C to A, chromosome 19 at 47,986,528 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7650 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045727-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.