Strain Name:
C57BL/6J-MtgxR7705Btlr/Mmmh
Stock Number:
045766-MU
Citation ID:
RRID:MMRRC_045766-MU
Other Names:
R7705 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: NRSF, 2610008J04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Gpr139
Name: G protein-coupled receptor 139
Synonyms: LOC209776, GPRg1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 209776
Homologene: 45860
Hmgcr
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Synonyms: Red, 3-hydroxy-3-methylglutaryl-CoA reductase, HMG-CoAR
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15357
HGNC: HGNC:5006
Homologene: 30994
Syt3
Name: synaptotagmin III
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20981
Homologene: 9617
E2f3
Name: E2F transcription factor 3
Synonyms: E2f3a, E2F3b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13557
HGNC: HGNC:3115
Homologene: 74413
Usp19
Name: ubiquitin specific peptidase 19
Synonyms: 8430421I07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71472
Homologene: 41730
Trip12
Name: thyroid hormone receptor interactor 12
Synonyms: 6720416K24Rik, Gtl6, 1110036I07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14897
Homologene: 44226
Tlk1
Name: tousled-like kinase 1
Synonyms: 4930545J15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228012
Homologene: 130657
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: tbl, D130015N03Rik, 2810449H11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Fam83h
Name: family with sequence similarity 83, member H
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105732
VEGA: 15
Homologene: 15890
Pdik1l
Name: PDLIM1 interacting kinase 1 like
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230809
Homologene: 36977
Csf2rb2
Name: colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
Synonyms: Bil3, Il3rb2, Il3r, BetaIl3, AIC2A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12984
VEGA: 15
HGNC: HGNC:2436
Homologene: 339
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: B430107L16Rik, 9630025C19Rik, 5033405M01Rik, Rab6ip2, RAB6IP2A, RAB6IP2B, Elks1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 111173
Homologene: 14229
Cand1
Name: cullin associated and neddylation disassociated 1
Synonyms: D10Ertd516e, 2310038O07Rik, 6330512O03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71902
Homologene: 10202
Cux2
Name: cut-like homeobox 2
Synonyms: Cutl2, Cux-2, 1700051K22Rik, ENSMUSG00000072641, Cux2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13048
Homologene: 22426
Isl2
Name: insulin related protein 2 (islet 2)
Synonyms: islet 2, islet-2, 3110001N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104360
Homologene: 10730
Mtr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase
Synonyms: methionine synthase, MS, D830038K18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238505
VEGA: 13
HGNC: HGNC:7468
Homologene: 37280
Pex19
Name: peroxisomal biogenesis factor 19
Synonyms: peroxisome biogenesis factor 19, Pxf
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19298
HGNC: HGNC:9713
Homologene: 134253
Ccdc171
Name: coiled-coil domain containing 171
Synonyms: 4930473A06Rik, A330015D16Rik, 4930418J05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320226
Homologene: 27942
Tbc1d20
Name: TBC1 domain family, member 20
Synonyms: 2810442O16Rik, 1110028I04Rik, bs
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67231
Homologene: 32574
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: Hug, 2410089E03Rik, b2b012Clo, Jbts17
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Abcb9
Name: ATP-binding cassette, sub-family B member 9
Synonyms: TAPL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56325
HGNC: HGNC:50
Homologene: 10491
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236537
Homologene: 45160
Tmem147
Name: transmembrane protein 147
Synonyms: 5033425B17Rik, 2010004E11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69804
Homologene: 12330
Slc28a2b
Name: solute carrier family 28 member 2b
Synonyms: Gm14085
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381417
Acad9
Name: acyl-Coenzyme A dehydrogenase family, member 9
Synonyms: 2600017P15Rik, NPD002, C630012L17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229211
Homologene: 8539
Or6c212
Name: olfactory receptor family 6 subfamily C member 212
Synonyms: MOR110-4, GA_x6K02T2PULF-11402237-11401278, Olfr805
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258548
Ankmy2
Name: ankyrin repeat and MYND domain containing 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217473
VEGA: 12
Homologene: 10662
Fbxw24
Name: F-box and WD-40 domain protein 24
Synonyms: Gm5162
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382106
Homologene: 110776
Meiosin
Name: meiosis initiator
Synonyms: Bhmg1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243866
Homologene: 131804
Dpep1
Name: dipeptidase 1
Synonyms: MBD
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13479
HGNC: HGNC:3002
Homologene: 80192
Ctsf
Name: cathepsin F
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56464
VEGA: 19
HGNC: HGNC:2531
Homologene: 31194
Edc3
Name: enhancer of mRNA decapping 3
Synonyms: Yjdc, Lsm16
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 353190
Homologene: 11827
Dytn
Name: dystrotelin
Synonyms: LOC241073
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241073
Homologene: 104042
Nlrp4c
Name: NLR family, pyrin domain containing 4C
Synonyms: Rnh2, Nalp-alpha, Nalp4c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83564
Homologene: 75315
Epha1
Name: Eph receptor A1
Synonyms: 5730453L17Rik, Esk, Eph
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13835
HGNC: HGNC:3385
Homologene: 3835
Fbxl14
Name: F-box and leucine-rich repeat protein 14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101358
Homologene: 15271
Marchf1
Name: membrane associated ring-CH-type finger 1
Synonyms: 2900024D24Rik, March1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72925
Homologene: 113749
Mrpl9
Name: mitochondrial ribosomal protein L9
Synonyms: 8030480E20Rik, C330013D18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78523
Homologene: 12696
Or5b12b
Name: olfactory receptor family 5 subfamily B member 12B
Synonyms: MOR202-7, Olfr1445, GA_x6K02T2RE5P-3213352-3214296
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258694
Homologene: 133606
Usp49
Name: ubiquitin specific peptidase 49
Synonyms: C330046L10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224836
Homologene: 10235
Spg7
Name: SPG7, paraplegin matrix AAA peptidase subunit
Synonyms: spastic paraplegia 7 homolog (human), paraplegin, Cmar
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234847
Homologene: 31133
Mterf2
Name: mitochondrial transcription termination factor 2
Synonyms: 1700007D05Rik, Mterfd3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74238
VEGA: 10
Homologene: 11869
Cpeb4
Name: cytoplasmic polyadenylation element binding protein 4
Synonyms: 4930447D24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67579
Homologene: 12736
Ulbp1
Name: UL16 binding protein 1
Synonyms: MULT1, A430108B07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77777
VEGA: 10
Homologene: 108274
Crtap
Name: cartilage associated protein
Synonyms: P3h5, 5730529N23Rik, Leprel3, CASP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56693
HGNC: HGNC:2379
Homologene: 21280
Lat
Name: linker for activation of T cells
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16797
Homologene: 7811
Gldn
Name: gliomedin
Synonyms: CRG-L2, Crlg2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235379
Homologene: 14529
Aadacl2fm3
Name: AADACL2 family member 3
Synonyms: Gm8298
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 666803
Homologene: 86204
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 63,678,789 bp
  • A to T, chromosome 1 at 84,777,449 bp
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp
  • A to T, chromosome 2 at 70,786,672 bp
  • A to C, chromosome 2 at 122,521,629 bp
  • G to C, chromosome 2 at 152,308,084 bp
  • C to T, chromosome 3 at 36,088,526 bp
  • G to A, chromosome 3 at 59,876,747 bp
  • A to G, chromosome 3 at 94,443,768 bp
  • A to G, chromosome 4 at 83,557,956 bp
  • A to G, chromosome 4 at 90,225,275 bp
  • A to G, chromosome 4 at 134,279,493 bp
  • T to A, chromosome 5 at 77,268,272 bp
  • T to A, chromosome 5 at 121,869,673 bp
  • G to T, chromosome 5 at 124,081,955 bp
  • A to G, chromosome 6 at 42,362,668 bp
  • A to T, chromosome 6 at 119,480,781 bp
  • A to G, chromosome 6 at 119,824,603 bp
  • T to A, chromosome 7 at 6,072,636 bp
  • T to A, chromosome 7 at 19,101,119 bp
  • T to G, chromosome 7 at 30,728,291 bp
  • T to C, chromosome 7 at 44,392,659 bp
  • T to C, chromosome 7 at 119,144,643 bp
  • T to C, chromosome 7 at 126,364,440 bp
  • T to C, chromosome 8 at 66,468,517 bp
  • A to C, chromosome 8 at 123,073,878 bp
  • T to C, chromosome 8 at 123,200,721 bp
  • T to A, chromosome 9 at 54,338,692 bp
  • T to C, chromosome 9 at 55,542,401 bp
  • T to C, chromosome 9 at 57,739,914 bp
  • G to T, chromosome 9 at 66,439,834 bp
  • A to G, chromosome 9 at 108,501,913 bp
  • A to T, chromosome 9 at 109,608,448 bp
  • A to T, chromosome 9 at 114,381,679 bp
  • A to G, chromosome 10 at 7,445,685 bp
  • G to T, chromosome 10 at 85,120,517 bp
  • A to G, chromosome 10 at 119,212,438 bp
  • T to A, chromosome 10 at 129,723,149 bp
  • A to G, chromosome 11 at 31,872,327 bp
  • A to G, chromosome 12 at 36,195,108 bp
  • A to G, chromosome 13 at 12,249,896 bp
  • G to A, chromosome 13 at 29,985,323 bp
  • A to G, chromosome 13 at 96,656,723 bp
  • T to G, chromosome 15 at 8,182,252 bp
  • C to T, chromosome 15 at 76,003,850 bp
  • T to C, chromosome 15 at 78,284,574 bp
  • T to C, chromosome 17 at 47,678,948 bp
  • T to G, chromosome 19 at 4,856,539 bp
  • A to G, chromosome 19 at 12,884,507 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7705 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045766-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.