Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7705Btlr/Mmmh
Stock Number:
045766-MU
Citation ID:
RRID:MMRRC_045766-MU
Other Names:
R7705 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: 2610008J04Rik, NRSF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Gpr139
Name: G protein-coupled receptor 139
Synonyms: LOC209776, GPRg1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 209776
Homologene: 45860
Hmgcr
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Synonyms: HMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15357
HGNC: HGNC:5006
Homologene: 30994
Syt3
Name: synaptotagmin III
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20981
Homologene: 9617
E2f3
Name: E2F transcription factor 3
Synonyms: E2F3b, E2f3a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13557
HGNC: HGNC:3115
Homologene: 74413
Usp19
Name: ubiquitin specific peptidase 19
Synonyms: 8430421I07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71472
Homologene: 41730
Trip12
Name: thyroid hormone receptor interactor 12
Synonyms: Gtl6, 1110036I07Rik, 6720416K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14897
Homologene: 44226
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 63,678,789 bp
  • A to T, chromosome 1 at 84,777,449 bp
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp
  • A to T, chromosome 2 at 70,786,672 bp
  • A to C, chromosome 2 at 122,521,629 bp
  • G to C, chromosome 2 at 152,308,084 bp
  • C to T, chromosome 3 at 36,088,526 bp
  • G to A, chromosome 3 at 59,876,747 bp
  • A to G, chromosome 3 at 94,443,768 bp
  • A to G, chromosome 4 at 83,557,956 bp
  • A to G, chromosome 4 at 90,225,275 bp
  • A to G, chromosome 4 at 134,279,493 bp
  • T to A, chromosome 5 at 77,268,272 bp
  • T to A, chromosome 5 at 121,869,673 bp
  • G to T, chromosome 5 at 124,081,955 bp
  • A to G, chromosome 6 at 42,362,668 bp
  • A to T, chromosome 6 at 119,480,781 bp
  • A to G, chromosome 6 at 119,824,603 bp
  • T to A, chromosome 7 at 6,072,636 bp
  • T to A, chromosome 7 at 19,101,119 bp
  • T to G, chromosome 7 at 30,728,291 bp
  • T to C, chromosome 7 at 44,392,659 bp
  • T to C, chromosome 7 at 119,144,643 bp
  • T to C, chromosome 7 at 126,364,440 bp
  • T to C, chromosome 8 at 66,468,517 bp
  • A to C, chromosome 8 at 123,073,878 bp
  • T to C, chromosome 8 at 123,200,721 bp
  • T to A, chromosome 9 at 54,338,692 bp
  • T to C, chromosome 9 at 55,542,401 bp
  • T to C, chromosome 9 at 57,739,914 bp
  • G to T, chromosome 9 at 66,439,834 bp
  • A to G, chromosome 9 at 108,501,913 bp
  • A to T, chromosome 9 at 109,608,448 bp
  • A to T, chromosome 9 at 114,381,679 bp
  • A to G, chromosome 10 at 7,445,685 bp
  • G to T, chromosome 10 at 85,120,517 bp
  • A to G, chromosome 10 at 119,212,438 bp
  • T to A, chromosome 10 at 129,723,149 bp
  • A to G, chromosome 11 at 31,872,327 bp
  • A to G, chromosome 12 at 36,195,108 bp
  • A to G, chromosome 13 at 12,249,896 bp
  • G to A, chromosome 13 at 29,985,323 bp
  • A to G, chromosome 13 at 96,656,723 bp
  • T to G, chromosome 15 at 8,182,252 bp
  • C to T, chromosome 15 at 76,003,850 bp
  • T to C, chromosome 15 at 78,284,574 bp
  • T to C, chromosome 17 at 47,678,948 bp
  • T to G, chromosome 19 at 4,856,539 bp
  • A to G, chromosome 19 at 12,884,507 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7705 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045766-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.