Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7715Btlr/Mmmh
Stock Number:
045773-MU
Citation ID:
RRID:MMRRC_045773-MU
Other Names:
R7715 (G1)
Major Collection:

Strain Information

Sh3gl2
Name: SH3-domain GRB2-like 2
Synonyms: EEN-B1, endophilin I, Sh3d2a, 9530001L19Rik, B930049H17Rik, endophilin A1, EEN1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20404
Homologene: 20652
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, OB-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Gon4l
Name: gon-4 like
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76022
Homologene: 13002
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Oxsr1
Name: oxidative-stress responsive 1
Synonyms: 2810422B09Rik, 2210022N24Rik, Osr1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108737
HGNC: HGNC:8508
Homologene: 31288
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 53,182,500 bp
  • G to A, chromosome 1 at 60,372,605 bp
  • A to T, chromosome 1 at 75,502,036 bp
  • C to T, chromosome 1 at 128,589,742 bp
  • A to G, chromosome 1 at 179,770,848 bp
  • A to G, chromosome 1 at 184,907,234 bp
  • A to T, chromosome 1 at 194,949,316 bp
  • A to G, chromosome 2 at 25,844,628 bp
  • A to G, chromosome 3 at 88,908,006 bp
  • C to T, chromosome 3 at 116,758,256 bp
  • A to G, chromosome 4 at 11,513,016 bp
  • C to T, chromosome 4 at 11,549,682 bp
  • T to A, chromosome 4 at 85,398,840 bp
  • G to T, chromosome 4 at 109,710,814 bp
  • C to T, chromosome 4 at 139,371,623 bp
  • A to T, chromosome 5 at 21,561,080 bp
  • T to A, chromosome 5 at 52,404,191 bp
  • A to G, chromosome 5 at 65,638,561 bp
  • A to G, chromosome 5 at 109,047,441 bp
  • A to G, chromosome 5 at 123,262,134 bp
  • A to C, chromosome 5 at 124,714,198 bp
  • T to C, chromosome 5 at 136,219,035 bp
  • T to C, chromosome 6 at 98,945,660 bp
  • T to C, chromosome 6 at 115,823,543 bp
  • C to T, chromosome 6 at 125,361,414 bp
  • A to G, chromosome 6 at 149,512,973 bp
  • T to C, chromosome 7 at 26,681,695 bp
  • GGCGGCGGC to GGCGGCGGCCGCGGCGGC, chromosome 7 at 97,579,912 bp
  • T to A, chromosome 7 at 102,494,461 bp
  • T to G, chromosome 7 at 127,549,288 bp
  • A to G, chromosome 8 at 61,006,760 bp
  • T to A, chromosome 8 at 102,664,714 bp
  • T to A, chromosome 9 at 15,060,785 bp
  • G to A, chromosome 9 at 20,212,435 bp
  • G to A, chromosome 9 at 20,212,436 bp
  • T to A, chromosome 9 at 38,209,479 bp
  • A to T, chromosome 9 at 39,237,878 bp
  • A to G, chromosome 9 at 83,865,153 bp
  • A to G, chromosome 9 at 119,242,756 bp
  • A to G, chromosome 10 at 4,450,751 bp
  • G to A, chromosome 10 at 28,863,309 bp
  • G to A, chromosome 10 at 42,683,187 bp
  • A to T, chromosome 10 at 88,995,311 bp
  • G to T, chromosome 10 at 112,271,940 bp
  • A to G, chromosome 10 at 128,317,723 bp
  • A to G, chromosome 11 at 50,310,804 bp
  • T to A, chromosome 11 at 59,543,003 bp
  • T to A, chromosome 11 at 61,066,952 bp
  • T to C, chromosome 11 at 68,557,550 bp
  • T to C, chromosome 11 at 70,096,895 bp
  • TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,100,036 bp
  • A to T, chromosome 11 at 115,849,728 bp
  • T to C, chromosome 11 at 121,639,796 bp
  • A to G, chromosome 12 at 71,988,901 bp
  • A to G, chromosome 12 at 102,218,960 bp
  • C to T, chromosome 12 at 119,446,256 bp
  • A to G, chromosome 13 at 9,614,391 bp
  • G to A, chromosome 14 at 12,457,762 bp
  • C to T, chromosome 14 at 79,466,294 bp
  • A to G, chromosome 15 at 55,487,983 bp
  • C to T, chromosome 16 at 19,514,730 bp
  • A to T, chromosome 16 at 49,013,984 bp
  • A to G, chromosome 16 at 87,719,971 bp
  • T to A, chromosome 17 at 19,611,915 bp
  • T to A, chromosome 17 at 74,368,926 bp
  • A to T, chromosome 18 at 37,966,642 bp
  • G to A, chromosome 18 at 77,968,586 bp
  • C to T, chromosome 19 at 5,141,681 bp
  • T to C, chromosome 19 at 38,189,838 bp
  • A to C, chromosome 19 at 55,088,921 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7715 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045773-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.