Strain Name:
C57BL/6J-MtgxR7727Btlr/Mmmh
Stock Number:
045783-MU
Citation ID:
RRID:MMRRC_045783-MU
Other Names:
R7727 (G1)
Major Collection:

Strain Information

Ubn2
Name: ubinuclein 2
Synonyms: 6030408G03Rik, 2900060J04Rik, D130059P03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320538
Homologene: 45564
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Cemip2
Name: cell migration inducing hyaluronidase 2
Synonyms: 3110012M15Rik, Tmem2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83921
VEGA: 19
Homologene: 75008
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Chst5
Name: carbohydrate sulfotransferase 5
Synonyms: I-GlcNAc6ST, GST-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56773
Homologene: 56927
Uba2
Name: ubiquitin-like modifier activating enzyme 2
Synonyms: Sumo-1 activating enzyme subunit 2, UBA2, anthracycline-associated resistance, Arx, SAE2, Uble1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50995
Homologene: 4018
Dgkh
Name: diacylglycerol kinase, eta
Synonyms: 5930402B05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380921
VEGA: 14
HGNC: HGNC:2854
Homologene: 99373
Nfkb1
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonyms: NF kappaB1, p50 subunit of NF kappaB, p50/p105, p50, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18033
HGNC: HGNC:7794
Homologene: 2971
Golga4
Name: golgin A4
Synonyms: golgin-245, Olp-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54214
HGNC: HGNC:4427
Homologene: 68224
Drosha
Name: drosha, ribonuclease type III
Synonyms: 1110013A17Rik, Etohi2, Rnasen
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14000
Homologene: 8293
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Tent3b, Zcchc6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Schip1
Name: schwannomin interacting protein 1
Synonyms: SCHIP-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30953
Homologene: 130673
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
Homologene: 87808
Rab28
Name: RAB28, member RAS oncogene family
Synonyms: 2700023P08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100972
HGNC: HGNC:9768
Homologene: 3135
Lrpprc
Name: leucine-rich PPR-motif containing
Synonyms: Lrp130, 3110001K13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72416
Homologene: 32695
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234344
Homologene: 128518
Bcl6
Name: B cell leukemia/lymphoma 6
Synonyms: Bcl5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12053
HGNC: HGNC:1001
Homologene: 7640
Ikzf1
Name: IKAROS family zinc finger 1
Synonyms: LyF-1, Ikaros, 5832432G11Rik, Zfpn1a1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22778
Homologene: 55948
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: LR11, mSorLA, 2900010L19Rik, Sorla
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Nol12
Name: nucleolar protein 12
Synonyms: C78541, Nop25
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 97961
Homologene: 32577
Prrg4
Name: proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)
Synonyms: TMG4, 9930111I18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228413
Homologene: 11451
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: Trrp7, LTRPC2, TRPC7, 9830168K16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28240
Homologene: 20709
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Atp8b1
Name: ATPase, class I, type 8B, member 1
Synonyms: FIC1, Ic
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 54670
VEGA: 18
HGNC: HGNC:3706
Homologene: 21151
Grm6
Name: glutamate receptor, metabotropic 6
Synonyms: mGluR6, nerg1, nob3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108072
HGNC: HGNC:4598
Homologene: 20232
Tamm41
Name: TAM41 mitochondrial translocator assembly and maintenance homolog
Synonyms: 1500001M20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68971
Homologene: 13754
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Snapc4
Name: small nuclear RNA activating complex, polypeptide 4
Synonyms: 5730436L13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227644
Homologene: 2321
Pik3r4
Name: phosphoinositide-3-kinase regulatory subunit 4
Synonyms: Vps15, p150
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75669
HGNC: HGNC:8982
Homologene: 24678
Kpna7
Name: karyopherin subunit alpha 7
Synonyms: LOC381686, importin alpha 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381686
Homologene: 73467
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Wdr31
Name: WD repeat domain 31
Synonyms: 5430402I10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71354
Homologene: 11360
Dpp6
Name: dipeptidylpeptidase 6
Synonyms: Dpp-6, Peplb, In(5)6H-p, Rw, LOC384168, B930011P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13483
HGNC: HGNC:3010
Homologene: 22560
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241116
Homologene: 28093
Krt81
Name: keratin 81
Synonyms: Krt2-19
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64818
VEGA: 15
HGNC: HGNC:6458
Homologene: 55645
B4galnt3
Name: beta-1,4-N-acetyl-galactosaminyl transferase 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330406
Homologene: 18328
Zfp110
Name: zinc finger protein 110
Synonyms: NRIF, 2900024E01Rik, Nrif1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 65020
Homologene: 129707
Serpina3f
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3F
Synonyms: 2A1, antitrypsin, alpha-1 antiproteinasin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238393
HGNC: HGNC:16
Homologene: 115927
Or13c25
Name: olfactory receptor family 13 subfamily C member 25
Synonyms: GA_x6K02T2N78B-7084885-7085844, MOR262-7, Olfr272
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258836
Homologene: 17409
Mboat1
Name: membrane bound O-acyltransferase domain containing 1
Synonyms: 9130215M02Rik, Oact1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218121
Homologene: 57467
Fsd1
Name: fibronectin type 3 and SPRY domain-containing protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240121
VEGA: 17
Homologene: 11531
Uevld
Name: UEV and lactate/malate dehyrogenase domains
Synonyms: 8430408E05Rik, Attp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54122
Homologene: 69251
Plxnc1
Name: plexin C1
Synonyms: vespr, 2510048K12Rik, CD232
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Piwil2
Name: piwi-like RNA-mediated gene silencing 2
Synonyms: Miwi like, mili
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57746
VEGA: 14
Homologene: 23071
Vps52
Name: VPS52 GARP complex subunit
Synonyms: ARE1, tcl-w5, D430041K17Rik, Sacm2l, tclw5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224705
Homologene: 5756
Spon2
Name: spondin 2, extracellular matrix protein
Synonyms: M-spondin, Mindin, 2310045I24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100689
Homologene: 40843
Sv2c
Name: synaptic vesicle glycoprotein 2c
Synonyms: 4930527L09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75209
Homologene: 57152
Ilvbl
Name: ilvB (bacterial acetolactate synthase)-like
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216136
VEGA: 10
HGNC: HGNC:6041
Homologene: 68532
Adamts5
Name: ADAM metallopeptidase with thrombospondin type 1 motif 5
Synonyms: ADAM-TS5, 9530092O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 23794
VEGA: 16
HGNC: HGNC:221
Homologene: 5109
Prss3b
Name: serine protease 3B
Synonyms: 2210010C04Rik, T7, cationic trypsinogen (isoform T7)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67373
Homologene: 134055
Slamf1
Name: signaling lymphocytic activation molecule family member 1
Synonyms: IPO-3, CD150, ESTM51, CDw150, Slam
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27218
Homologene: 48162
Naga
Name: N-acetyl galactosaminidase, alpha
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17939
VEGA: 15
HGNC: HGNC:7631
Homologene: 221
Gabra1
Name: gamma-aminobutyric acid type A receptor subunit alpha 1
Synonyms: GABAA alpha 1, Gabra-1, GABAAR alpha1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14394
HGNC: HGNC:4075
Homologene: 629
Arhgap18
Name: Rho GTPase activating protein 18
Synonyms: 4833419J07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73910
Homologene: 14135
Meltf
Name: melanotransferrin
Synonyms: MTf, CD228, melanotransferrin, Mfi2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30060
VEGA: 16
HGNC: HGNC:7037
Homologene: 4335
Upp2
Name: uridine phosphorylase 2
Synonyms: UDRPASE2, UPASE2, UP2, 1700124F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76654
Homologene: 12654
Sh3tc2
Name: SH3 domain and tetratricopeptide repeats 2
Synonyms: D430044G18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225608
VEGA: 18
Homologene: 11596
Cd5l
Name: CD5 antigen-like
Synonyms: AAC-11, AIM/Spalpha, Sp-alpha, Pdp 1/6, Api6, AIM
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11801
HGNC: HGNC:1690
Homologene: 55936
Cldn20
Name: claudin 20
Synonyms: EG621628
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 621628
VEGA: 17
HGNC: HGNC:2042
Homologene: 47972
Ttc34
Name: tetratricopeptide repeat domain 34
Synonyms: B230396O12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242800
Homologene: 130480
Or5g23
Name: olfactory receptor family 5 subfamily G member 23
Synonyms: GA_x6K02T2Q125-47087719-47086775, MOR175-9, Olfr1000
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257899
Pcdhga5
Name: protocadherin gamma subfamily A, 5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93713
HGNC: HGNC:8703
Homologene: 69263
Or8u3-ps
Name: olfactory receptor family 8 subfamily U member 3
Synonyms: GA_x6K02T2Q125-47591072-47592031, MOR185-3, Olfr1038-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259015
Homologene: 17463
Lalba
Name: lactalbumin, alpha
Synonyms: lactalbumin alpha
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16770
VEGA: 15
HGNC: HGNC:6480
Homologene: 1720
Kcng2
Name: potassium voltage-gated channel, subfamily G, member 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240444
HGNC: HGNC:6249
Homologene: 8178
Zfp367
Name: zinc finger protein 367
Synonyms: 8030486J21Rik, ZFF29b, ZFF29a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238673
Homologene: 17802
Cc2d2b
Name: coiled-coil and C2 domain containing 2B
Synonyms: EG668310
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668310
Homologene: 141114
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 74,926,625 bp
  • T to C, chromosome 1 at 82,528,793 bp
  • G to A, chromosome 1 at 171,774,899 bp
  • T to G, chromosome 2 at 26,373,434 bp
  • G to A, chromosome 2 at 58,774,148 bp
  • A to G, chromosome 2 at 85,608,407 bp
  • A to T, chromosome 2 at 86,122,496 bp
  • A to T, chromosome 2 at 104,839,378 bp
  • G to A, chromosome 3 at 68,064,984 bp
  • G to T, chromosome 3 at 87,367,855 bp
  • A to C, chromosome 3 at 135,585,401 bp
  • A to G, chromosome 4 at 52,911,368 bp
  • A to T, chromosome 4 at 62,460,636 bp
  • G to A, chromosome 4 at 154,839,274 bp
  • A to G, chromosome 5 at 27,451,244 bp
  • G to A, chromosome 5 at 33,215,675 bp
  • A to G, chromosome 5 at 41,707,970 bp
  • A to T, chromosome 5 at 113,274,327 bp
  • T to C, chromosome 5 at 145,005,045 bp
  • T to A, chromosome 6 at 38,463,938 bp
  • C to A, chromosome 6 at 41,033,193 bp
  • C to T, chromosome 6 at 115,016,178 bp
  • A to T, chromosome 6 at 120,225,187 bp
  • T to A, chromosome 7 at 12,848,995 bp
  • C to T, chromosome 7 at 34,150,850 bp
  • T to C, chromosome 7 at 46,943,805 bp
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp
  • A to T, chromosome 8 at 111,890,925 bp
  • T to A, chromosome 9 at 18,660,242 bp
  • A to G, chromosome 9 at 41,984,526 bp
  • A to G, chromosome 9 at 105,669,882 bp
  • T to A, chromosome 9 at 118,548,702 bp
  • A to T, chromosome 10 at 26,870,011 bp
  • C to A, chromosome 10 at 58,455,438 bp
  • T to C, chromosome 10 at 77,925,789 bp
  • G to A, chromosome 10 at 78,576,666 bp
  • T to C, chromosome 10 at 94,944,109 bp
  • T to A, chromosome 11 at 11,748,339 bp
  • T to C, chromosome 11 at 35,684,044 bp
  • T to C, chromosome 11 at 42,133,591 bp
  • C to A, chromosome 11 at 50,851,542 bp
  • A to G, chromosome 11 at 67,215,922 bp
  • T to G, chromosome 12 at 104,218,218 bp
  • A to C, chromosome 13 at 30,226,306 bp
  • A to G, chromosome 13 at 59,799,682 bp
  • A to T, chromosome 13 at 64,145,643 bp
  • A to G, chromosome 13 at 95,976,695 bp
  • C to T, chromosome 14 at 70,394,057 bp
  • A to G, chromosome 14 at 78,595,145 bp
  • A to G, chromosome 15 at 12,881,645 bp
  • C to A, chromosome 15 at 78,940,593 bp
  • C to A, chromosome 15 at 82,330,147 bp
  • T to C, chromosome 15 at 98,482,668 bp
  • A to G, chromosome 15 at 101,459,567 bp
  • A to G, chromosome 16 at 23,971,413 bp
  • T to C, chromosome 16 at 31,883,794 bp
  • A to T, chromosome 16 at 85,899,966 bp
  • T to C, chromosome 17 at 3,532,755 bp
  • T to A, chromosome 17 at 33,962,134 bp
  • T to G, chromosome 17 at 55,988,150 bp
  • T to C, chromosome 17 at 84,776,947 bp
  • C to A, chromosome 18 at 33,854,273 bp
  • T to C, chromosome 18 at 37,695,045 bp
  • A to T, chromosome 18 at 61,989,580 bp
  • T to A, chromosome 18 at 64,545,275 bp
  • C to T, chromosome 18 at 80,296,090 bp
  • T to C, chromosome 19 at 18,854,249 bp
  • C to T, chromosome 19 at 21,829,957 bp
  • T to A, chromosome 19 at 40,756,530 bp
  • T to C, chromosome 19 at 61,119,941 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7727 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045783-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.