Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7727Btlr/Mmmh
Stock Number:
045783-MU
Citation ID:
RRID:MMRRC_045783-MU
Other Names:
R7727 (G1)
Major Collection:

Strain Information

Ubn2
Name: ubinuclein 2
Synonyms: 6030408G03Rik, 2900060J04Rik, D130059P03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320538
Homologene: 45564
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Cemip2
Name: cell migration inducing hyaluronidase 2
Synonyms: 3110012M15Rik, Tmem2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83921
VEGA: 19
Homologene: 75008
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Chst5
Name: carbohydrate sulfotransferase 5
Synonyms: I-GlcNAc6ST, GST-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56773
Homologene: 56927
Uba2
Name: ubiquitin-like modifier activating enzyme 2
Synonyms: Sumo-1 activating enzyme subunit 2, UBA2, anthracycline-associated resistance, Arx, SAE2, Uble1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50995
Homologene: 4018
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 74,926,625 bp
  • T to C, chromosome 1 at 82,528,793 bp
  • G to A, chromosome 1 at 171,774,899 bp
  • T to G, chromosome 2 at 26,373,434 bp
  • G to A, chromosome 2 at 58,774,148 bp
  • A to G, chromosome 2 at 85,608,407 bp
  • A to T, chromosome 2 at 86,122,496 bp
  • A to T, chromosome 2 at 104,839,378 bp
  • G to A, chromosome 3 at 68,064,984 bp
  • G to T, chromosome 3 at 87,367,855 bp
  • A to C, chromosome 3 at 135,585,401 bp
  • A to G, chromosome 4 at 52,911,368 bp
  • A to T, chromosome 4 at 62,460,636 bp
  • G to A, chromosome 4 at 154,839,274 bp
  • A to G, chromosome 5 at 27,451,244 bp
  • G to A, chromosome 5 at 33,215,675 bp
  • A to G, chromosome 5 at 41,707,970 bp
  • A to T, chromosome 5 at 113,274,327 bp
  • T to C, chromosome 5 at 145,005,045 bp
  • T to A, chromosome 6 at 38,463,938 bp
  • C to A, chromosome 6 at 41,033,193 bp
  • C to T, chromosome 6 at 115,016,178 bp
  • A to T, chromosome 6 at 120,225,187 bp
  • T to A, chromosome 7 at 12,848,995 bp
  • C to T, chromosome 7 at 34,150,850 bp
  • T to C, chromosome 7 at 46,943,805 bp
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp
  • A to T, chromosome 8 at 111,890,925 bp
  • T to A, chromosome 9 at 18,660,242 bp
  • A to G, chromosome 9 at 41,984,526 bp
  • A to G, chromosome 9 at 105,669,882 bp
  • T to A, chromosome 9 at 118,548,702 bp
  • A to T, chromosome 10 at 26,870,011 bp
  • C to A, chromosome 10 at 58,455,438 bp
  • T to C, chromosome 10 at 77,925,789 bp
  • G to A, chromosome 10 at 78,576,666 bp
  • T to C, chromosome 10 at 94,944,109 bp
  • T to A, chromosome 11 at 11,748,339 bp
  • T to C, chromosome 11 at 35,684,044 bp
  • T to C, chromosome 11 at 42,133,591 bp
  • C to A, chromosome 11 at 50,851,542 bp
  • A to G, chromosome 11 at 67,215,922 bp
  • T to G, chromosome 12 at 104,218,218 bp
  • A to C, chromosome 13 at 30,226,306 bp
  • A to G, chromosome 13 at 59,799,682 bp
  • A to T, chromosome 13 at 64,145,643 bp
  • A to G, chromosome 13 at 95,976,695 bp
  • C to T, chromosome 14 at 70,394,057 bp
  • A to G, chromosome 14 at 78,595,145 bp
  • A to G, chromosome 15 at 12,881,645 bp
  • C to A, chromosome 15 at 78,940,593 bp
  • C to A, chromosome 15 at 82,330,147 bp
  • T to C, chromosome 15 at 98,482,668 bp
  • A to G, chromosome 15 at 101,459,567 bp
  • A to G, chromosome 16 at 23,971,413 bp
  • T to C, chromosome 16 at 31,883,794 bp
  • A to T, chromosome 16 at 85,899,966 bp
  • T to C, chromosome 17 at 3,532,755 bp
  • T to A, chromosome 17 at 33,962,134 bp
  • T to G, chromosome 17 at 55,988,150 bp
  • T to C, chromosome 17 at 84,776,947 bp
  • C to A, chromosome 18 at 33,854,273 bp
  • T to C, chromosome 18 at 37,695,045 bp
  • A to T, chromosome 18 at 61,989,580 bp
  • T to A, chromosome 18 at 64,545,275 bp
  • C to T, chromosome 18 at 80,296,090 bp
  • T to C, chromosome 19 at 18,854,249 bp
  • C to T, chromosome 19 at 21,829,957 bp
  • T to A, chromosome 19 at 40,756,530 bp
  • T to C, chromosome 19 at 61,119,941 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7727 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045783-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.