Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7748Btlr/Mmmh
Stock Number:
045804-MU
Citation ID:
RRID:MMRRC_045804-MU
Other Names:
R7748 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Igf2bp1
Name: insulin-like growth factor 2 mRNA binding protein 1
Synonyms: CRD-BP, Crdbp, IMP-1, Zbp1, D030026A21Rik, D11Moh45, D11Moh40e, IMP1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140486
Homologene: 4772
Cdk4
Name: cyclin dependent kinase 4
Synonyms: p34PSK-J3/cdk4, Crk3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12567
HGNC: HGNC:1773
Homologene: 55429
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Bcl2l2
Name: BCL2-like 2
Synonyms: bclw, Gtrgal2, Gtrosa41, Bcl-w
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12050
HGNC: HGNC:995
Homologene: 2989
Unc93b1
Name: unc-93 homolog B1, TLR signaling regulator
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54445
Homologene: 41325
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 24,028,969 bp
  • A to T, chromosome 1 at 63,177,865 bp
  • A to G, chromosome 1 at 67,139,806 bp
  • G to A, chromosome 1 at 104,941,299 bp
  • A to G, chromosome 1 at 134,189,228 bp
  • A to T, chromosome 1 at 151,182,974 bp
  • A to T, chromosome 1 at 171,159,940 bp
  • T to A, chromosome 1 at 174,666,649 bp
  • G to C, chromosome 1 at 177,772,202 bp
  • T to A, chromosome 2 at 12,230,239 bp
  • T to A, chromosome 2 at 25,578,959 bp
  • T to A, chromosome 2 at 25,824,914 bp
  • T to A, chromosome 2 at 87,508,699 bp
  • G to A, chromosome 2 at 121,052,808 bp
  • A to T, chromosome 2 at 160,966,619 bp
  • C to T, chromosome 2 at 181,234,531 bp
  • G to A, chromosome 3 at 36,465,331 bp
  • A to G, chromosome 3 at 36,959,335 bp
  • A to G, chromosome 3 at 98,138,484 bp
  • A to T, chromosome 3 at 104,825,405 bp
  • A to T, chromosome 3 at 135,326,179 bp
  • C to A, chromosome 4 at 11,579,924 bp
  • T to A, chromosome 4 at 40,262,654 bp
  • T to C, chromosome 4 at 76,099,504 bp
  • T to C, chromosome 4 at 117,131,728 bp
  • T to C, chromosome 4 at 143,135,889 bp
  • T to C, chromosome 4 at 148,605,706 bp
  • A to T, chromosome 5 at 36,229,175 bp
  • A to C, chromosome 5 at 41,832,340 bp
  • T to A, chromosome 5 at 65,619,666 bp
  • C to T, chromosome 5 at 107,562,244 bp
  • T to A, chromosome 5 at 108,149,041 bp
  • A to T, chromosome 5 at 124,716,496 bp
  • T to C, chromosome 5 at 125,109,967 bp
  • T to C, chromosome 5 at 142,904,695 bp
  • T to C, chromosome 6 at 18,277,889 bp
  • C to A, chromosome 6 at 29,177,191 bp
  • C to A, chromosome 6 at 48,449,465 bp
  • G to T, chromosome 6 at 48,597,345 bp
  • C to A, chromosome 6 at 54,595,520 bp
  • T to A, chromosome 6 at 57,978,564 bp
  • C to G, chromosome 6 at 89,337,352 bp
  • T to A, chromosome 6 at 89,337,353 bp
  • T to C, chromosome 6 at 113,340,328 bp
  • T to A, chromosome 6 at 135,209,351 bp
  • T to C, chromosome 7 at 7,132,908 bp
  • G to C, chromosome 7 at 19,136,533 bp
  • G to A, chromosome 7 at 25,307,328 bp
  • A to T, chromosome 7 at 30,540,072 bp
  • A to T, chromosome 7 at 86,921,135 bp
  • A to G, chromosome 7 at 96,894,702 bp
  • A to G, chromosome 7 at 103,418,481 bp
  • A to G, chromosome 7 at 107,624,558 bp
  • T to C, chromosome 7 at 108,894,078 bp
  • A to T, chromosome 7 at 120,115,479 bp
  • A to T, chromosome 7 at 125,829,801 bp
  • T to A, chromosome 7 at 131,361,792 bp
  • A to T, chromosome 7 at 139,574,995 bp
  • A to G, chromosome 7 at 141,847,805 bp
  • TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA to TCCACAGGAACTACA, chromosome 7 at 142,175,108 bp
  • A to T, chromosome 8 at 53,511,805 bp
  • T to A, chromosome 9 at 67,963,089 bp
  • T to C, chromosome 9 at 87,032,381 bp
  • A to G, chromosome 9 at 106,719,034 bp
  • T to C, chromosome 9 at 107,615,735 bp
  • T to G, chromosome 9 at 110,980,931 bp
  • A to G, chromosome 10 at 12,614,508 bp
  • A to T, chromosome 10 at 80,016,932 bp
  • A to T, chromosome 10 at 85,941,968 bp
  • T to A, chromosome 10 at 115,400,815 bp
  • C to T, chromosome 10 at 127,064,429 bp
  • T to C, chromosome 11 at 20,332,252 bp
  • TCACACTCGGCACA to TCACA, chromosome 11 at 50,815,240 bp
  • T to C, chromosome 11 at 55,398,600 bp
  • T to G, chromosome 11 at 60,504,901 bp
  • T to C, chromosome 11 at 69,355,633 bp
  • T to G, chromosome 11 at 73,336,254 bp
  • T to G, chromosome 11 at 73,486,168 bp
  • T to A, chromosome 11 at 83,422,398 bp
  • T to C, chromosome 11 at 95,967,587 bp
  • C to T, chromosome 11 at 100,011,602 bp
  • T to A, chromosome 11 at 100,038,938 bp
  • T to C, chromosome 11 at 100,266,966 bp
  • C to T, chromosome 11 at 120,654,801 bp
  • A to G, chromosome 12 at 51,371,667 bp
  • T to G, chromosome 12 at 51,389,357 bp
  • A to T, chromosome 12 at 64,474,407 bp
  • C to T, chromosome 12 at 72,216,926 bp
  • A to T, chromosome 12 at 98,688,772 bp
  • G to A, chromosome 12 at 103,605,061 bp
  • T to C, chromosome 12 at 104,130,463 bp
  • C to T, chromosome 12 at 113,964,650 bp
  • C to T, chromosome 13 at 12,227,839 bp
  • C to T, chromosome 13 at 24,803,399 bp
  • T to A, chromosome 14 at 16,290,820 bp
  • C to T, chromosome 14 at 54,884,379 bp
  • A to T, chromosome 14 at 55,651,112 bp
  • T to G, chromosome 15 at 6,638,826 bp
  • C to T, chromosome 15 at 9,652,945 bp
  • C to A, chromosome 15 at 12,385,786 bp
  • T to C, chromosome 15 at 26,387,830 bp
  • C to T, chromosome 15 at 36,122,269 bp
  • T to A, chromosome 15 at 98,604,556 bp
  • T to C, chromosome 15 at 102,719,561 bp
  • A to T, chromosome 16 at 20,633,084 bp
  • T to C, chromosome 16 at 91,630,652 bp
  • A to G, chromosome 17 at 13,948,652 bp
  • G to A, chromosome 17 at 35,252,750 bp
  • T to C, chromosome 17 at 67,750,590 bp
  • A to G, chromosome 17 at 80,265,117 bp
  • T to A, chromosome 19 at 3,935,250 bp
  • T to A, chromosome 19 at 30,993,091 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7748 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045804-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.