Strain Name:
C57BL/6J-MtgxR7748Btlr/Mmmh
Stock Number:
045804-MU
Citation ID:
RRID:MMRRC_045804-MU
Other Names:
R7748 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, DRP, Dmdl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Igf2bp1
Name: insulin-like growth factor 2 mRNA binding protein 1
Synonyms: IMP-1, D11Moh40e, CRD-BP, Crdbp, IMP1, D030026A21Rik, D11Moh45, Zbp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140486
Homologene: 4772
Cdk4
Name: cyclin dependent kinase 4
Synonyms: p34PSK-J3/cdk4, Crk3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12567
HGNC: HGNC:1773
Homologene: 55429
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Bcl2l2
Name: BCL2-like 2
Synonyms: Gtrgal2, bclw, Gtrosa41, Bcl-w
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12050
Homologene: 2989
Unc93b1
Name: unc-93 homolog B1, TLR signaling regulator
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54445
Homologene: 41325
Plk3
Name: polo like kinase 3
Synonyms: Cnk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12795
HGNC: HGNC:2154
Homologene: 20865
Inpp5a
Name: inositol polyphosphate-5-phosphatase A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212111
HGNC: HGNC:6076
Homologene: 4045
Rad54l2
Name: RAD54 like 2 (S. cerevisiae)
Synonyms: Arip4, Srisnf2l, G630026H09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81000
Homologene: 56698
Gnai2
Name: G protein subunit alpha i2
Synonyms: Gnai-2, Galphai2, Gia
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14678
HGNC: HGNC:4385
Homologene: 55539
Lrrc2
Name: leucine rich repeat containing 2
Synonyms: 4933431K03Rik, 2400002D05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74249
Homologene: 23454
Pdzd2
Name: PDZ domain containing 2
Synonyms: LOC223364, A930022H17Rik, 4930537L06Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Topors
Name: topoisomerase I binding, arginine/serine-rich
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 106021
Homologene: 4237
Gart
Name: phosphoribosylglycinamide formyltransferase
Synonyms: Prgs, Gaps
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14450
HGNC: HGNC:4163
Homologene: 637
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: LOC381568, KMT8, Riz, E330024L24Rik, 4833427P12Rik, Riz1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Fmn2
Name: formin 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54418
Homologene: 137334
Plxna1
Name: plexin A1
Synonyms: 2600013D04Rik, NOV, PlexA1, Plxn1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Pds5a
Name: PDS5 cohesin associated factor A
Synonyms: 9030416H16Rik, E230024D05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71521
Homologene: 22877
2310057M21Rik
Name: RIKEN cDNA 2310057M21 gene
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68277
Homologene: 11793
Ptpn21
Name: protein tyrosine phosphatase, non-receptor type 21
Synonyms: PTPRL10, PTPD1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 24000
VEGA: 12
HGNC: HGNC:9651
Homologene: 5110
Eef1b2
Name: eukaryotic translation elongation factor 1 beta 2
Synonyms: 2810017J07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 55949
HGNC: HGNC:3208
Homologene: 1480
Actb
Name: actin, beta
Synonyms: E430023M04Rik, Actx, A-X actin-like protein, beta-actin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11461
HGNC: HGNC:132
Homologene: 110648
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: 4932438A13Rik, Tweek, FSA
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Ddx39b
Name: DEAD box helicase 39b
Synonyms: 0610030D10Rik, D17H6S81E-1, Bat1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B, Bat-1, Bat1a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53817
Homologene: 48376
Ncor2
Name: nuclear receptor co-repressor 2
Synonyms: SMRTe, SMRT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20602
HGNC: HGNC:7673
Homologene: 31370
Scfd1
Name: Sec1 family domain containing 1
Synonyms: 3110021P21Rik, STXBP1L2, RA410
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76983
VEGA: 12
Homologene: 5650
Cyb5r4
Name: cytochrome b5 reductase 4
Synonyms: b5/b5r, B5+B5R, 2810034J18Rik, Ncb5or
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 266690
Homologene: 69207
Cftr
Name: cystic fibrosis transmembrane conductance regulator
Synonyms: Abcc7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12638
HGNC: HGNC:1884
Homologene: 55465
Rtn1
Name: reticulon 1
Synonyms: Rtn1-c, 0710005K15Rik, Rtn1-a, Nsp, 4930441F12Rik, Rtn1-b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104001
Homologene: 49654
Krt33a
Name: keratin 33A
Synonyms: 2310015J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71888
Homologene: 74433
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665775
Homologene: 45109
Adss2
Name: adenylosuccinate synthase 2
Synonyms: AS, Adss
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11566
HGNC: HGNC:292
Homologene: 875
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: Doc4, l7Rn3, ELM2, Odz4, l(7)-3Rn, Ten-m4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Calcoco1
Name: calcium binding and coiled coil domain 1
Synonyms: 1810009B06Rik, CoCoA, Gcap11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67488
Homologene: 10845
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Anxa5
Name: annexin A5
Synonyms: annexin V, Anx5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11747
HGNC: HGNC:543
Homologene: 20312
Mtr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase
Synonyms: MS, D830038K18Rik, methionine synthase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238505
VEGA: 13
HGNC: HGNC:7468
Homologene: 37280
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68187
Homologene: 32665
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 5430439G14Rik, 6330406J24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Katnip
Name: katanin interacting protein
Synonyms: D430042O09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233865
Homologene: 45841
G2e3
Name: G2/M-phase specific E3 ubiquitin ligase
Synonyms: 6030408C04Rik, D930034K21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217558
Homologene: 32362
Fbxo46
Name: F-box protein 46
Synonyms: 20D7-FC4, Fbxo34l, 4932704E22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243867
Homologene: 18467
Zfc3h1
Name: zinc finger, C3H1-type containing
Synonyms: Ccdc131, Psrc2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216345
Homologene: 17017
Marchf11
Name: membrane associated ring-CH-type finger 11
Synonyms: March11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 211147
Homologene: 45584
Prkg1
Name: protein kinase, cGMP-dependent, type I
Synonyms: Prkg1b, Prkgr1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19091
HGNC: HGNC:9414
Homologene: 55964
Myo15a
Name: myosin XVA
Synonyms: Myo15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17910
HGNC: HGNC:7594
Homologene: 56504
Camk1
Name: calcium/calmodulin-dependent protein kinase I
Synonyms: Camk, CaMKIalpha, D6Ertd263e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52163
HGNC: HGNC:1459
Homologene: 117458
Dhx57
Name: DExH-box helicase 57
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106794
VEGA: 17
Homologene: 56267
Fyb1
Name: FYN binding protein 1
Synonyms: Fyb, FYB-120/130, ADAP, B630013F22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 23880
HGNC: HGNC:4036
Homologene: 22664
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: B230219D21Rik, 1110002J03Rik, 3000002J10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Tgm5
Name: transglutaminase 5
Synonyms: TGx, 2310007C07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74176
Homologene: 20899
Slc9b2
Name: solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2
Synonyms: NHA2, NHE10, C80638, nha-oc, Nhedc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 97086
Homologene: 45381
Proser3
Name: proline and serine rich 3
Synonyms: BC053749
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 333193
Homologene: 116064
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Chd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229003
Homologene: 14118
Rtcb
Name: RNA 2',3'-cyclic phosphate and 5'-OH ligase
Synonyms: D10Wsu52e, HSPC117
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28088
Homologene: 36344
Krt34
Name: keratin 34
Synonyms: Krt1-4, 4733401E01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16672
HGNC: HGNC:6452
Homologene: 31083
Vmn2r78
Name: vomeronasal 2, receptor 78
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637896
Homologene: 115466
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: 2300002I04Rik, MUC5, MUC9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Gas2l2
Name: growth arrest-specific 2 like 2
Synonyms: OTTMUSG00000000934
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237891
Homologene: 16409
Fscb
Name: fibrous sheath CABYR binding protein
Synonyms: EG623046
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 623046
VEGA: 12
Homologene: 136275
Gm7168
Name: predicted gene 7168
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 635895
Homologene: 133217
Chi3l1
Name: chitinase 3 like 1
Synonyms: Brp39, Chil1, Gp39
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12654
HGNC: HGNC:1932
Homologene: 55569
Fam234b
Name: family with sequence similarity 234, member B
Synonyms: 8430419L09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74525
Homologene: 12572
Glmn
Name: glomulin, FKBP associated protein
Synonyms: 9330160J16Rik, Fap48, Fap68
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170823
Homologene: 14239
Slc1a4
Name: solute carrier family 1 (glutamate/neutral amino acid transporter), member 4
Synonyms: ASCT1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 55963
Homologene: 20655
Sspo
Name: SCO-spondin
Synonyms: Scospondin, C79529
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Tmem145
Name: transmembrane protein 145
Synonyms: B930076A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330485
Homologene: 18333
BC005537
Name: cDNA sequence BC005537
Synonyms: 8030460C05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 79555
Homologene: 11551
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: D1Ucla3, 4732433M03Rik, CPSase I, CPS
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Ppp4r4
Name: protein phosphatase 4, regulatory subunit 4
Synonyms: 8430415E04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74521
Homologene: 12571
Atp6v0a2
Name: ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms: 8430408C20Rik, TJ6s, V-ATPase a2, Atp6n2, ATP6a2, Tj6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21871
Homologene: 56523
Krt42
Name: keratin 42
Synonyms: ecat6, K17n, 2410039E07Rik, Ka22
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68239
Homologene: 107091
Serpina3b
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3B
Synonyms: A030003A19Rik, 6A1, alpha-1 antiproteinase, antitrypsin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271047
HGNC: HGNC:16
Homologene: 120222
Prrt4
Name: proline-rich transmembrane protein 4
Synonyms: D330027H18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101359
Homologene: 46116
Spata22
Name: spermatogenesis associated 22
Synonyms: LOC380709
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380709
Homologene: 13076
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Adcy6
Name: adenylate cyclase 6
Synonyms: AC6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11512
VEGA: 15
HGNC: HGNC:237
Homologene: 22400
Tssk4
Name: testis-specific serine kinase 4
Synonyms: 4933424F08Rik, 1700020B19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71099
VEGA: 14
Homologene: 57078
Or1e22
Name: olfactory receptor family 1 subfamily E member 22
Synonyms: MOR135-4, GA_x6K02T2P1NL-3646409-3645474, Olfr381
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259024
Sorcs2
Name: sortilin-related VPS10 domain containing receptor 2
Synonyms: VPS10 domain receptor protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81840
Homologene: 56899
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626596
Homologene: 75047
Notum
Name: notum palmitoleoyl-protein carboxylesterase
Synonyms: 5730593N15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77583
Homologene: 45335
Mpz
Name: myelin protein zero
Synonyms: P0, Mpp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17528
HGNC: HGNC:7225
Homologene: 445
Vmn1r25
Name: vomeronasal 1 receptor 25
Synonyms: V1rc8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113865
Homologene: 137652
Ngly1
Name: N-glycanase 1
Synonyms: 1110002C09Rik, PNGase, Png1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 59007
Homologene: 10117
Repin1
Name: replication initiator 1
Synonyms: Zfp464, E430037F08Rik, AP4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58887
Homologene: 22810
Masp2
Name: MBL associated serine protease 2
Synonyms: MAp19, MASP-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17175
HGNC: HGNC:6902
Homologene: 4819
Ajm1
Name: apical junction component 1
Synonyms: Gm996, LOC381353
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381353
Homologene: 19943
Zfp773
Name: zinc finger protein 773
Synonyms: 2810409K11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76373
Homologene: 137393
Arhgap45
Name: Rho GTPase activating protein 45
Synonyms: Hmha1, 6330406L22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70719
Homologene: 69120
Zfp354c
Name: zinc finger protein 354C
Synonyms: AJ18, 5330421P20Rik, Kid3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30944
Homologene: 56606
Ldaf1
Name: lipid droplet assembly factor 1
Synonyms: Tmem159, 8430420C20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233806
Homologene: 10705
Or10a3n
Name: olfactory receptor family 10 subfamily A member 3N
Synonyms: Olfr519, MOR268-6, GA_x6K02T2PBJ9-11224559-11223615
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277935
Homologene: 17186
Krtap5-2
Name: keratin associated protein 5-2
Synonyms: 4833428E21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71623
5330417H12Rik
Name: RIKEN cDNA 5330417H12 gene
Type: Gene
Species: Mouse
Chromosome: 7
Fsbp
Name: fibrinogen silencer binding protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100503583
Homologene: 132087
Pramel6
Name: PRAME like 6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 347711
Homologene: 77635
Lcn9
Name: lipocalin 9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77704
Homologene: 12681
Aga
Name: aspartylglucosaminidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11593
HGNC: HGNC:318
Homologene: 13
Capza1
Name: capping actin protein of muscle Z-line subunit alpha 1
Synonyms: Cappa1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12340
HGNC: HGNC:1488
Homologene: 24376
Sparc
Name: secreted acidic cysteine rich glycoprotein
Synonyms: BM-40, osteonectin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20692
Homologene: 31132
Fkbp14
Name: FK506 binding protein 14
Synonyms: FKBP22
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231997
Homologene: 23059
Ighv3-1
Name: immunoglobulin heavy variable 3-1
Synonyms: Gm16610
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 780803
Gm49333
Name: predicted gene, 49333
Type: Gene
Species: Mouse
Chromosome: 16
Gm47985
Name: predicted gene, 47985
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 24,028,969 bp
  • A to T, chromosome 1 at 63,177,865 bp
  • A to G, chromosome 1 at 67,139,806 bp
  • G to A, chromosome 1 at 104,941,299 bp
  • A to G, chromosome 1 at 134,189,228 bp
  • A to T, chromosome 1 at 151,182,974 bp
  • A to T, chromosome 1 at 171,159,940 bp
  • T to A, chromosome 1 at 174,666,649 bp
  • G to C, chromosome 1 at 177,772,202 bp
  • T to A, chromosome 2 at 12,230,239 bp
  • T to A, chromosome 2 at 25,578,959 bp
  • T to A, chromosome 2 at 25,824,914 bp
  • T to A, chromosome 2 at 87,508,699 bp
  • G to A, chromosome 2 at 121,052,808 bp
  • A to T, chromosome 2 at 160,966,619 bp
  • C to T, chromosome 2 at 181,234,531 bp
  • G to A, chromosome 3 at 36,465,331 bp
  • A to G, chromosome 3 at 36,959,335 bp
  • A to G, chromosome 3 at 98,138,484 bp
  • A to T, chromosome 3 at 104,825,405 bp
  • A to T, chromosome 3 at 135,326,179 bp
  • C to A, chromosome 4 at 11,579,924 bp
  • T to A, chromosome 4 at 40,262,654 bp
  • T to C, chromosome 4 at 76,099,504 bp
  • T to C, chromosome 4 at 117,131,728 bp
  • T to C, chromosome 4 at 143,135,889 bp
  • T to C, chromosome 4 at 148,605,706 bp
  • A to T, chromosome 5 at 36,229,175 bp
  • A to C, chromosome 5 at 41,832,340 bp
  • T to A, chromosome 5 at 65,619,666 bp
  • C to T, chromosome 5 at 107,562,244 bp
  • T to A, chromosome 5 at 108,149,041 bp
  • A to T, chromosome 5 at 124,716,496 bp
  • T to C, chromosome 5 at 125,109,967 bp
  • T to C, chromosome 5 at 142,904,695 bp
  • T to C, chromosome 6 at 18,277,889 bp
  • C to A, chromosome 6 at 29,177,191 bp
  • C to A, chromosome 6 at 48,449,465 bp
  • G to T, chromosome 6 at 48,597,345 bp
  • C to A, chromosome 6 at 54,595,520 bp
  • T to A, chromosome 6 at 57,978,564 bp
  • C to G, chromosome 6 at 89,337,352 bp
  • T to A, chromosome 6 at 89,337,353 bp
  • T to C, chromosome 6 at 113,340,328 bp
  • T to A, chromosome 6 at 135,209,351 bp
  • T to C, chromosome 7 at 7,132,908 bp
  • G to C, chromosome 7 at 19,136,533 bp
  • G to A, chromosome 7 at 25,307,328 bp
  • A to T, chromosome 7 at 30,540,072 bp
  • A to T, chromosome 7 at 86,921,135 bp
  • A to G, chromosome 7 at 96,894,702 bp
  • A to G, chromosome 7 at 103,418,481 bp
  • A to G, chromosome 7 at 107,624,558 bp
  • T to C, chromosome 7 at 108,894,078 bp
  • A to T, chromosome 7 at 120,115,479 bp
  • A to T, chromosome 7 at 125,829,801 bp
  • T to A, chromosome 7 at 131,361,792 bp
  • A to T, chromosome 7 at 139,574,995 bp
  • A to G, chromosome 7 at 141,847,805 bp
  • TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA to TCCACAGGAACTACA, chromosome 7 at 142,175,108 bp
  • A to T, chromosome 8 at 53,511,805 bp
  • T to A, chromosome 9 at 67,963,089 bp
  • T to C, chromosome 9 at 87,032,381 bp
  • A to G, chromosome 9 at 106,719,034 bp
  • T to C, chromosome 9 at 107,615,735 bp
  • T to G, chromosome 9 at 110,980,931 bp
  • A to G, chromosome 10 at 12,614,508 bp
  • A to T, chromosome 10 at 80,016,932 bp
  • A to T, chromosome 10 at 85,941,968 bp
  • T to A, chromosome 10 at 115,400,815 bp
  • C to T, chromosome 10 at 127,064,429 bp
  • T to C, chromosome 11 at 20,332,252 bp
  • TCACACTCGGCACA to TCACA, chromosome 11 at 50,815,240 bp
  • T to C, chromosome 11 at 55,398,600 bp
  • T to G, chromosome 11 at 60,504,901 bp
  • T to C, chromosome 11 at 69,355,633 bp
  • T to G, chromosome 11 at 73,336,254 bp
  • T to G, chromosome 11 at 73,486,168 bp
  • T to A, chromosome 11 at 83,422,398 bp
  • T to C, chromosome 11 at 95,967,587 bp
  • C to T, chromosome 11 at 100,011,602 bp
  • T to A, chromosome 11 at 100,038,938 bp
  • T to C, chromosome 11 at 100,266,966 bp
  • C to T, chromosome 11 at 120,654,801 bp
  • A to G, chromosome 12 at 51,371,667 bp
  • T to G, chromosome 12 at 51,389,357 bp
  • A to T, chromosome 12 at 64,474,407 bp
  • C to T, chromosome 12 at 72,216,926 bp
  • A to T, chromosome 12 at 98,688,772 bp
  • G to A, chromosome 12 at 103,605,061 bp
  • T to C, chromosome 12 at 104,130,463 bp
  • C to T, chromosome 12 at 113,964,650 bp
  • C to T, chromosome 13 at 12,227,839 bp
  • C to T, chromosome 13 at 24,803,399 bp
  • T to A, chromosome 14 at 16,290,820 bp
  • C to T, chromosome 14 at 54,884,379 bp
  • A to T, chromosome 14 at 55,651,112 bp
  • T to G, chromosome 15 at 6,638,826 bp
  • C to T, chromosome 15 at 9,652,945 bp
  • C to A, chromosome 15 at 12,385,786 bp
  • T to C, chromosome 15 at 26,387,830 bp
  • C to T, chromosome 15 at 36,122,269 bp
  • T to A, chromosome 15 at 98,604,556 bp
  • T to C, chromosome 15 at 102,719,561 bp
  • A to T, chromosome 16 at 20,633,084 bp
  • T to C, chromosome 16 at 91,630,652 bp
  • A to G, chromosome 17 at 13,948,652 bp
  • G to A, chromosome 17 at 35,252,750 bp
  • T to C, chromosome 17 at 67,750,590 bp
  • A to G, chromosome 17 at 80,265,117 bp
  • T to A, chromosome 19 at 3,935,250 bp
  • T to A, chromosome 19 at 30,993,091 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7748 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045804-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.