Strain Name:
C57BL/6J-MtgxR7753Btlr/Mmmh
Stock Number:
045809-MU
Citation ID:
RRID:MMRRC_045809-MU
Other Names:
R7753 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Vcan
Name: versican
Synonyms: DPEAAE, 5430420N07Rik, Cspg2, hdf, heart defect, PG-M
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Itk
Name: IL2 inducible T cell kinase
Synonyms: Tcsk, Emt, Tsk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Dbh
Name: dopamine beta hydroxylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13166
HGNC: HGNC:2689
Homologene: 615
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 4921505C17Rik, 6030405M08Rik, D530039E11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Taok1
Name: TAO kinase 1
Synonyms: 2810468K05Rik, D130018F14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216965
Homologene: 27041
Gdi2
Name: GDP dissociation inhibitor 2
Synonyms: GDIB, GDI-B, GDI beta, Gdi3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Ap2b1
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71770
HGNC: HGNC:563
Homologene: 137384
Ddx10
Name: DEAD box helicase 10
Synonyms: 4632415A01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77591
VEGA: 9
HGNC: HGNC:2735
Homologene: 20922
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: Dopey1, B130005I07Rik, D9Ertd809e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Usp53
Name: ubiquitin specific peptidase 53
Synonyms: mbo, Sp6, Phxr3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99526
Homologene: 34521
Fzd7
Name: frizzled class receptor 7
Synonyms: Fz7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14369
HGNC: HGNC:4045
Homologene: 20751
Mlh1
Name: mutL homolog 1
Synonyms: 1110035C23Rik, colon cancer, nonpolyposis type 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17350
HGNC: HGNC:7127
Homologene: 208
Neo1
Name: neogenin
Synonyms: D930014N22Rik, 2610028H22Rik, Igdcc2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18007
VEGA: 9
HGNC: HGNC:7754
Homologene: 1870
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: heb, eyem02Jus, crf11, eyes2, QBRICK
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Prr14l
Name: proline rich 14-like
Synonyms: C330019G07Rik, 6030436E02Rik, Prl14l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215476
Homologene: 65866
Epg5
Name: ectopic P-granules 5 autophagy tethering factor
Synonyms: 5430411K18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100502841
VEGA: 18
Homologene: 14575
Osbpl9
Name: oxysterol binding protein-like 9
Synonyms: 2600011I06Rik, ORP-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100273
Homologene: 69380
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, 1810009A16Rik, Zubr1, D930005K06Rik, p600, LOC381562
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Atp6v1b1
Name: ATPase, H+ transporting, lysosomal V1 subunit B1
Synonyms: D630030L16Rik, D630039P21Rik, lysosomal 56/58kDa, Atp6b1, Vpp3, Vpp-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 110935
HGNC: HGNC:853
Homologene: 68198
Ppt1
Name: palmitoyl-protein thioesterase 1
Synonyms: D4Ertd184e, CLN1, 9530043G02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19063
HGNC: HGNC:9325
Homologene: 7488
Farsb
Name: phenylalanyl-tRNA synthetase, beta subunit
Synonyms: PheRS alpha, Farsl, Farslb, Frsb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23874
Homologene: 4160
Cntrl
Name: centriolin
Synonyms: b2b1468Clo, Ma2a8, 6720467O09Rik, IB3/5, Cep110, Cep1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Hnrnpul2
Name: heterogeneous nuclear ribonucleoprotein U-like 2
Synonyms: Hnrpul2, 1110031M08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68693
VEGA: 19
Homologene: 28583
Dapk1
Name: death associated protein kinase 1
Synonyms: DAP-Kinase, D13Ucla1, 2810425C21Rik, 2310039H24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Tmem98
Name: transmembrane protein 98
Synonyms: Rwhs, 6530411B15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103743
Homologene: 9185
Gpr155
Name: G protein-coupled receptor 155
Synonyms: 1110017O10Rik, PGR22, F730029F15Rik, DEPDC3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68526
Homologene: 16584
Aqp4
Name: aquaporin 4
Synonyms: aquaporin-4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11829
VEGA: 18
HGNC: HGNC:637
Homologene: 37507
Lce1m
Name: late cornified envelope 1M
Synonyms: Lce5a, Sprrl10, 1110059L13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66203
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E21Rik, 2310076E16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: D12Ertd777e, Cpfl8, dice, 6820443O06Rik, nesprin-2, syne-2, Nesp2g, diminished cone electroretinogram
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Ush2a
Name: usherin
Synonyms: Ushrn, A930037M10Rik, MUSH2A, LOC269160, A930011D15Rik, LOC381317, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Zbtb41
Name: zinc finger and BTB domain containing 41
Synonyms: 9830132G07Rik, 8430415N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226470
Homologene: 27795
Sugct
Name: succinyl-CoA glutarate-CoA transferase
Synonyms: 5033411D12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 192136
VEGA: 13
Homologene: 11681
Ulk4
Name: unc-51-like kinase 4
Synonyms: 4932415A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209012
Homologene: 41205
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Mroh1
Name: maestro heat-like repeat family member 1
Synonyms: D330001F17Rik, Heatr7a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223658
Homologene: 44882
Sprr3
Name: small proline-rich protein 3
Synonyms: SPR3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20766
Homologene: 135951
AI661453
Name: expressed sequence AI661453
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224833
Homologene: 138294
Or5m5
Name: olfactory receptor family 5 subfamily M member 5
Synonyms: GA_x6K02T2Q125-47462755-47463693, MOR196-2, Olfr1030
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258581
Homologene: 64892
Vmn2r72
Name: vomeronasal 2, receptor 72
Synonyms: EG244114, Vmn2r72-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244114
Homologene: 115466
Papss2
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Synonyms: Sk2, Atpsk2, 1810018P12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 23972
VEGA: 19
HGNC: HGNC:8604
Homologene: 55840
Nol4
Name: nucleolar protein 4
Synonyms: 4930568N03Rik, LOC383304, 1700013J13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319211
HGNC: HGNC:7870
Homologene: 36142
Slc2a7
Name: solute carrier family 2 (facilitated glucose transporter), member 7
Synonyms: OTTMUSG00000010396
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435818
Homologene: 72470
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Zfp518a
Name: zinc finger protein 518A
Synonyms: 6330417C12Rik, 2810401C22Rik, Zfp518
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72672
VEGA: 19
Homologene: 19378
Fam171a1
Name: family with sequence similarity 171, member A1
Synonyms: 9630050M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269233
Homologene: 19521
Vstm2a
Name: V-set and transmembrane domain containing 2A
Synonyms: Vstm2, 9330184N17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 211739
Homologene: 17123
Oasl2
Name: 2'-5' oligoadenylate synthetase-like 2
Synonyms: M1204, Mmu-OASL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23962
Homologene: 128369
Or56a5
Name: olfactory receptor family 56 subfamily A member 5
Synonyms: MOR40-1, Olfr683, GA_x6K02T2PBJ9-7773007-7772066
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259047
Homologene: 133645
Hdac7
Name: histone deacetylase 7
Synonyms: 5830434K02Rik, Hdac7a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56233
Homologene: 9124
Nr1h3
Name: nuclear receptor subfamily 1, group H, member 3
Synonyms: LXR alpha, Unr1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22259
HGNC: HGNC:7966
Homologene: 21165
Vmn2r96
Name: vomeronasal 2, receptor 96
Synonyms: EG433070
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433070
P3h2
Name: prolyl 3-hydroxylase 2
Synonyms: Leprel1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 210530
Homologene: 10062
Spata31e4
Name: spermatogenesis associated 31 subfamily E member 4
Synonyms: Gm8765
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 667693
Homologene: 134512
Cep44
Name: centrosomal protein 44
Synonyms: BC088983, 4933440G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382010
Homologene: 12738
Prkcz
Name: protein kinase C, zeta
Synonyms: zetaPKC, aPKCzeta, Pkcz
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18762
HGNC: HGNC:9412
Homologene: 55681
Or10ag59
Name: olfactory receptor family 10 subfamily AG member 59
Synonyms: MOR264-9P, MOR264-23, GA_x6K02T2Q125-49078087-49079031, Olfr1129
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258111
Homologene: 133705
Thoc5
Name: THO complex 5
Synonyms: Fmip, 1700060C24Rik, PK1.3, A430085L24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107829
Homologene: 37836
Kcnab2
Name: potassium voltage-gated channel, shaker-related subfamily, beta member 2
Synonyms: I2rf5, F5, I2rf5, Kcnb3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16498
HGNC: HGNC:6229
Homologene: 56492
Cyp2d12
Name: cytochrome P450, family 2, subfamily d, polypeptide 12
Synonyms: 9030605E09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380997
VEGA: 15
Homologene: 86099
Prss51
Name: serine protease 51
Synonyms: 1700007N14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504162
Homologene: 131540
Mapk8ip2
Name: mitogen-activated protein kinase 8 interacting protein 2
Synonyms: 3230402N03Rik, Jip2, JNK-interacting protein, IB2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 60597
HGNC: HGNC:6883
Homologene: 8201
Or4f14
Name: olfactory receptor family 4 subfamily F member 14
Synonyms: MOR245-15, GA_x6K02T2Q125-72954873-72953935, Olfr1306
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258023
Homologene: 128383
Tbc1d21
Name: TBC1 domain family, member 21
Synonyms: 1700095K08Rik, MgcRabGAP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74286
VEGA: 9
Homologene: 14033
Mapk10
Name: mitogen-activated protein kinase 10
Synonyms: Serk2, p493F12, JNK3, C230008H04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26414
HGNC: HGNC:6872
Homologene: 56439
Cyp4a14
Name: cytochrome P450, family 4, subfamily a, polypeptide 14
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13119
Homologene: 134697
Tox3
Name: TOX high mobility group box family member 3
Synonyms: Tnrc9, 500-9, CAGF9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244579
Homologene: 18257
Krtap5-2
Name: keratin associated protein 5-2
Synonyms: 4833428E21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71623
Ifi27l2b
Name: interferon, alpha-inducible protein 27 like 2B
Synonyms: 1810023F06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217845
Homologene: 137395
Or10z1
Name: olfactory receptor family 10 subfamily Z member 1
Synonyms: GA_x6K02T2P20D-20891507-20892448, MOR267-6, Olfr419
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258710
Homologene: 72017
Fzd4
Name: frizzled class receptor 4
Synonyms: Fz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14366
HGNC: HGNC:4042
Homologene: 7325
Zfp397
Name: zinc finger protein 397
Synonyms: 6720480F11Rik, 2810411K16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69256
VEGA: 18
Homologene: 117445
Pcdha4
Name: protocadherin alpha 4
Synonyms: Cnr1, Crnr1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12936
HGNC: HGNC:8670
Homologene: 130626
C1rb
Name: complement component 1, r subcomponent B
Synonyms: mC1rB, Gm8551
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 667277
HGNC: HGNC:1246
Homologene: 1313
Igkv4-91
Name: immunoglobulin kappa chain variable 4-91
Synonyms: ENSMUSG00000056850, Gm10879
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 434033
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 59,483,482 bp
  • T to A, chromosome 1 at 78,480,103 bp
  • A to G, chromosome 1 at 139,447,157 bp
  • C to T, chromosome 1 at 174,250,670 bp
  • A to G, chromosome 1 at 188,443,406 bp
  • A to T, chromosome 2 at 3,178,317 bp
  • A to G, chromosome 2 at 27,171,436 bp
  • T to C, chromosome 2 at 35,111,679 bp
  • A to T, chromosome 2 at 73,382,206 bp
  • A to G, chromosome 2 at 85,984,716 bp
  • A to G, chromosome 2 at 87,575,797 bp
  • A to G, chromosome 2 at 91,185,025 bp
  • A to G, chromosome 2 at 111,912,582 bp
  • G to A, chromosome 3 at 92,457,108 bp
  • C to A, chromosome 3 at 93,018,508 bp
  • G to A, chromosome 3 at 122,949,238 bp
  • T to C, chromosome 4 at 82,913,980 bp
  • T to C, chromosome 4 at 109,133,773 bp
  • G to T, chromosome 4 at 115,493,664 bp
  • A to T, chromosome 4 at 122,836,338 bp
  • T to C, chromosome 4 at 139,470,292 bp
  • T to C, chromosome 4 at 150,154,684 bp
  • T to C, chromosome 4 at 152,396,761 bp
  • T to A, chromosome 4 at 155,272,968 bp
  • G to T, chromosome 5 at 32,827,253 bp
  • T to A, chromosome 5 at 103,038,553 bp
  • A to G, chromosome 5 at 114,905,057 bp
  • T to G, chromosome 6 at 68,768,777 bp
  • G to T, chromosome 6 at 83,752,458 bp
  • A to G, chromosome 6 at 124,580,431 bp
  • G to A, chromosome 7 at 85,750,626 bp
  • T to A, chromosome 7 at 89,407,784 bp
  • T to C, chromosome 7 at 105,143,800 bp
  • GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC to GCCACAGCCTCC, chromosome 7 at 142,175,399 bp
  • A to G, chromosome 8 at 56,532,807 bp
  • A to G, chromosome 8 at 90,248,932 bp
  • A to T, chromosome 9 at 53,225,604 bp
  • A to C, chromosome 9 at 58,362,023 bp
  • A to T, chromosome 9 at 58,956,005 bp
  • T to G, chromosome 9 at 67,395,473 bp
  • A to G, chromosome 9 at 86,489,702 bp
  • C to A, chromosome 9 at 111,252,863 bp
  • A to G, chromosome 9 at 121,266,512 bp
  • T to C, chromosome 11 at 4,902,156 bp
  • G to T, chromosome 11 at 16,263,040 bp
  • T to A, chromosome 11 at 46,331,895 bp
  • T to C, chromosome 11 at 77,537,899 bp
  • A to G, chromosome 11 at 80,814,311 bp
  • A to T, chromosome 11 at 83,367,907 bp
  • T to C, chromosome 11 at 110,184,107 bp
  • TTGCAACACACCAGGCTGAACTGGACCTTGCTG to TTG, chromosome 11 at 116,457,042 bp
  • G to A, chromosome 12 at 76,038,923 bp
  • T to A, chromosome 12 at 103,451,260 bp
  • A to G, chromosome 13 at 3,548,956 bp
  • A to T, chromosome 13 at 17,577,519 bp
  • A to T, chromosome 13 at 50,701,781 bp
  • T to C, chromosome 13 at 60,751,193 bp
  • T to A, chromosome 13 at 89,689,323 bp
  • T to C, chromosome 13 at 93,098,172 bp
  • T to A, chromosome 14 at 64,095,927 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • A to G, chromosome 15 at 76,433,275 bp
  • A to T, chromosome 15 at 82,556,963 bp
  • A to G, chromosome 15 at 89,461,653 bp
  • A to T, chromosome 15 at 97,800,761 bp
  • G to T, chromosome 15 at 97,806,488 bp
  • A to T, chromosome 16 at 25,970,937 bp
  • A to T, chromosome 17 at 18,586,401 bp
  • G to T, chromosome 17 at 47,467,514 bp
  • T to C, chromosome 17 at 84,252,390 bp
  • T to C, chromosome 18 at 15,399,976 bp
  • T to A, chromosome 18 at 23,038,602 bp
  • A to T, chromosome 18 at 23,957,072 bp
  • C to A, chromosome 18 at 36,953,301 bp
  • A to G, chromosome 18 at 77,948,345 bp
  • T to C, chromosome 19 at 8,824,972 bp
  • A to T, chromosome 19 at 32,620,179 bp
  • A to T, chromosome 19 at 40,915,805 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7753 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045809-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.