Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7753Btlr/Mmmh
Stock Number:
045809-MU
Citation ID:
RRID:MMRRC_045809-MU
Other Names:
R7753 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Dbh
Name: dopamine beta hydroxylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13166
HGNC: HGNC:2689
Homologene: 615
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Taok1
Name: TAO kinase 1
Synonyms: D130018F14Rik, 2810468K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216965
Homologene: 27041
Gdi2
Name: GDP dissociation inhibitor 2
Synonyms: GDI beta, GDI-B, GDIB, Gdi3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 59,483,482 bp
  • T to A, chromosome 1 at 78,480,103 bp
  • A to G, chromosome 1 at 139,447,157 bp
  • C to T, chromosome 1 at 174,250,670 bp
  • A to G, chromosome 1 at 188,443,406 bp
  • A to T, chromosome 2 at 3,178,317 bp
  • A to G, chromosome 2 at 27,171,436 bp
  • T to C, chromosome 2 at 35,111,679 bp
  • A to T, chromosome 2 at 73,382,206 bp
  • A to G, chromosome 2 at 85,984,716 bp
  • A to G, chromosome 2 at 87,575,797 bp
  • A to G, chromosome 2 at 91,185,025 bp
  • A to G, chromosome 2 at 111,912,582 bp
  • G to A, chromosome 3 at 92,457,108 bp
  • C to A, chromosome 3 at 93,018,508 bp
  • G to A, chromosome 3 at 122,949,238 bp
  • T to C, chromosome 4 at 82,913,980 bp
  • T to C, chromosome 4 at 109,133,773 bp
  • G to T, chromosome 4 at 115,493,664 bp
  • A to T, chromosome 4 at 122,836,338 bp
  • T to C, chromosome 4 at 139,470,292 bp
  • T to C, chromosome 4 at 150,154,684 bp
  • T to C, chromosome 4 at 152,396,761 bp
  • T to A, chromosome 4 at 155,272,968 bp
  • G to T, chromosome 5 at 32,827,253 bp
  • T to A, chromosome 5 at 103,038,553 bp
  • A to G, chromosome 5 at 114,905,057 bp
  • T to G, chromosome 6 at 68,768,777 bp
  • G to T, chromosome 6 at 83,752,458 bp
  • A to G, chromosome 6 at 124,580,431 bp
  • G to A, chromosome 7 at 85,750,626 bp
  • T to A, chromosome 7 at 89,407,784 bp
  • T to C, chromosome 7 at 105,143,800 bp
  • GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC to GCCACAGCCTCC, chromosome 7 at 142,175,399 bp
  • A to G, chromosome 8 at 56,532,807 bp
  • A to G, chromosome 8 at 90,248,932 bp
  • A to T, chromosome 9 at 53,225,604 bp
  • A to C, chromosome 9 at 58,362,023 bp
  • A to T, chromosome 9 at 58,956,005 bp
  • T to G, chromosome 9 at 67,395,473 bp
  • A to G, chromosome 9 at 86,489,702 bp
  • C to A, chromosome 9 at 111,252,863 bp
  • A to G, chromosome 9 at 121,266,512 bp
  • T to C, chromosome 11 at 4,902,156 bp
  • G to T, chromosome 11 at 16,263,040 bp
  • T to A, chromosome 11 at 46,331,895 bp
  • T to C, chromosome 11 at 77,537,899 bp
  • A to G, chromosome 11 at 80,814,311 bp
  • A to T, chromosome 11 at 83,367,907 bp
  • T to C, chromosome 11 at 110,184,107 bp
  • TTGCAACACACCAGGCTGAACTGGACCTTGCTG to TTG, chromosome 11 at 116,457,042 bp
  • G to A, chromosome 12 at 76,038,923 bp
  • T to A, chromosome 12 at 103,451,260 bp
  • A to G, chromosome 13 at 3,548,956 bp
  • A to T, chromosome 13 at 17,577,519 bp
  • A to T, chromosome 13 at 50,701,781 bp
  • T to C, chromosome 13 at 60,751,193 bp
  • T to A, chromosome 13 at 89,689,323 bp
  • T to C, chromosome 13 at 93,098,172 bp
  • T to A, chromosome 14 at 64,095,927 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • A to G, chromosome 15 at 76,433,275 bp
  • A to T, chromosome 15 at 82,556,963 bp
  • A to G, chromosome 15 at 89,461,653 bp
  • A to T, chromosome 15 at 97,800,761 bp
  • G to T, chromosome 15 at 97,806,488 bp
  • A to T, chromosome 16 at 25,970,937 bp
  • A to T, chromosome 17 at 18,586,401 bp
  • G to T, chromosome 17 at 47,467,514 bp
  • T to C, chromosome 17 at 84,252,390 bp
  • T to C, chromosome 18 at 15,399,976 bp
  • T to A, chromosome 18 at 23,038,602 bp
  • A to T, chromosome 18 at 23,957,072 bp
  • C to A, chromosome 18 at 36,953,301 bp
  • A to G, chromosome 18 at 77,948,345 bp
  • T to C, chromosome 19 at 8,824,972 bp
  • A to T, chromosome 19 at 32,620,179 bp
  • A to T, chromosome 19 at 40,915,805 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7753 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045809-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.