Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7773Btlr/Mmmh
Stock Number:
045829-MU
Citation ID:
RRID:MMRRC_045829-MU
Other Names:
R7773 (G1)
Major Collection:

Strain Information

Gon4l
Name: gon-4 like
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76022
Homologene: 13002
Pcm1
Name: pericentriolar material 1
Synonyms: 9430077F19Rik, 2600002H09Rik, C030044G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18536
HGNC: HGNC:8727
Homologene: 4518
Sirt1
Name: sirtuin 1
Synonyms: Sir2, Sir2alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 93759
Homologene: 56556
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78885
Homologene: 11573
Cep170
Name: centrosomal protein 170
Synonyms: 4933426L22Rik, A330004A13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545389
Homologene: 22844
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,499,522 bp
  • A to T, chromosome 1 at 37,835,242 bp
  • A to C, chromosome 1 at 39,565,218 bp
  • T to C, chromosome 1 at 126,026,844 bp
  • A to T, chromosome 1 at 151,811,596 bp
  • A to G, chromosome 1 at 176,740,076 bp
  • G to T, chromosome 2 at 29,786,508 bp
  • C to T, chromosome 2 at 35,354,594 bp
  • T to C, chromosome 2 at 86,314,690 bp
  • A to G, chromosome 2 at 152,695,511 bp
  • T to C, chromosome 2 at 154,613,187 bp
  • A to T, chromosome 2 at 160,910,798 bp
  • A to G, chromosome 3 at 69,016,163 bp
  • A to G, chromosome 3 at 88,895,795 bp
  • A to G, chromosome 3 at 124,412,531 bp
  • A to G, chromosome 3 at 136,890,461 bp
  • T to C, chromosome 4 at 66,839,599 bp
  • T to C, chromosome 4 at 130,220,376 bp
  • A to T, chromosome 4 at 144,703,477 bp
  • A to G, chromosome 5 at 41,832,712 bp
  • A to C, chromosome 5 at 52,368,301 bp
  • G to A, chromosome 5 at 73,607,321 bp
  • A to G, chromosome 5 at 107,140,502 bp
  • G to T, chromosome 5 at 122,109,272 bp
  • A to G, chromosome 5 at 124,001,441 bp
  • A to G, chromosome 6 at 48,906,212 bp
  • A to G, chromosome 6 at 53,931,905 bp
  • A to T, chromosome 6 at 57,258,659 bp
  • A to G, chromosome 6 at 71,373,815 bp
  • T to C, chromosome 6 at 83,979,214 bp
  • T to A, chromosome 6 at 135,243,914 bp
  • T to A, chromosome 7 at 10,037,635 bp
  • T to A, chromosome 7 at 76,698,837 bp
  • T to A, chromosome 7 at 90,229,912 bp
  • T to C, chromosome 7 at 141,529,605 bp
  • C to T, chromosome 8 at 13,248,682 bp
  • G to T, chromosome 8 at 41,309,573 bp
  • A to C, chromosome 8 at 71,679,042 bp
  • T to C, chromosome 8 at 84,864,152 bp
  • T to C, chromosome 8 at 121,651,775 bp
  • T to C, chromosome 9 at 106,568,613 bp
  • T to C, chromosome 9 at 108,054,668 bp
  • T to A, chromosome 9 at 110,312,559 bp
  • T to A, chromosome 10 at 63,326,783 bp
  • A to G, chromosome 11 at 97,050,722 bp
  • A to T, chromosome 11 at 99,792,841 bp
  • T to C, chromosome 12 at 66,284,267 bp
  • T to C, chromosome 13 at 27,318,142 bp
  • T to C, chromosome 13 at 31,627,199 bp
  • C to T, chromosome 13 at 45,078,951 bp
  • T to C, chromosome 13 at 92,661,084 bp
  • A to G, chromosome 13 at 96,410,635 bp
  • A to G, chromosome 13 at 105,082,285 bp
  • GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC to GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC, chromosome 14 at 14,119,882 bp
  • C to T, chromosome 14 at 103,248,404 bp
  • T to C, chromosome 15 at 98,639,938 bp
  • A to C, chromosome 15 at 101,414,032 bp
  • A to G, chromosome 16 at 4,632,006 bp
  • A to G, chromosome 16 at 44,789,687 bp
  • T to A, chromosome 19 at 13,365,234 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7773 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045829-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.