Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7786Btlr/Mmmh
Stock Number:
045842-MU
Citation ID:
RRID:MMRRC_045842-MU
Other Names:
R7786 (G1)
Major Collection:

Strain Information

Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Plin3
Name: perilipin 3
Synonyms: 1300012C15Rik, Tip47, M6prbp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66905
VEGA: 17
Homologene: 4247
Hdac11
Name: histone deacetylase 11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232232
Homologene: 11743
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: 2310079H06Rik, D030051N19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228361
Homologene: 18204
Gatad2b
Name: GATA zinc finger domain containing 2B
Synonyms: C430014D17Rik, p66beta
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229542
Homologene: 32484
Emc8
Name: ER membrane protein complex subunit 8
Synonyms: Noc4, Fam158b, Cox4nb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18117
HGNC: HGNC:7864
Homologene: 4424
Gstcd
Name: glutathione S-transferase, C-terminal domain containing
Synonyms: 4933434L15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67553
Homologene: 11693
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 135,469,995 bp
  • G to T, chromosome 1 at 170,920,857 bp
  • C to A, chromosome 2 at 27,386,601 bp
  • A to T, chromosome 2 at 69,781,748 bp
  • A to T, chromosome 2 at 87,746,301 bp
  • G to C, chromosome 2 at 91,767,796 bp
  • T to C, chromosome 3 at 90,355,679 bp
  • A to G, chromosome 3 at 95,484,956 bp
  • C to T, chromosome 3 at 133,082,107 bp
  • A to G, chromosome 4 at 63,394,962 bp
  • C to A, chromosome 5 at 115,863,018 bp
  • C to A, chromosome 5 at 134,390,899 bp
  • G to A, chromosome 6 at 23,036,993 bp
  • T to A, chromosome 6 at 41,355,529 bp
  • T to A, chromosome 6 at 91,173,176 bp
  • T to C, chromosome 7 at 25,317,695 bp
  • T to A, chromosome 7 at 87,295,842 bp
  • G to A, chromosome 7 at 104,040,723 bp
  • T to A, chromosome 7 at 104,617,718 bp
  • C to A, chromosome 7 at 117,643,475 bp
  • A to G, chromosome 7 at 125,865,294 bp
  • C to T, chromosome 7 at 133,675,035 bp
  • C to T, chromosome 8 at 24,611,118 bp
  • C to T, chromosome 8 at 85,085,456 bp
  • T to A, chromosome 8 at 105,518,874 bp
  • T to C, chromosome 8 at 120,667,917 bp
  • A to C, chromosome 11 at 36,010,449 bp
  • C to T, chromosome 11 at 60,776,966 bp
  • T to A, chromosome 12 at 78,719,629 bp
  • T to C, chromosome 12 at 85,266,737 bp
  • C to A, chromosome 13 at 96,404,519 bp
  • T to C, chromosome 13 at 105,054,060 bp
  • A to T, chromosome 14 at 31,262,521 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • T to A, chromosome 15 at 76,309,716 bp
  • T to A, chromosome 15 at 101,890,530 bp
  • A to T, chromosome 17 at 37,070,063 bp
  • G to A, chromosome 17 at 56,279,757 bp
  • T to A, chromosome 17 at 73,709,981 bp
  • G to C, chromosome 18 at 50,047,111 bp
  • C to T, chromosome 18 at 50,047,112 bp
  • T to C, chromosome 18 at 74,792,447 bp
  • A to G, chromosome 19 at 41,321,585 bp
  • AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC to AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC, chromosome X at 61,184,524 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7786 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045842-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.