Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7830Btlr/Mmmh
Stock Number:
045884-MU
Citation ID:
RRID:MMRRC_045884-MU
Other Names:
R7830 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Serpinb6a
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonyms: Spi3, ovalbumin, D330015H01Rik, 4930482L21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20719
HGNC: HGNC:8950
Homologene: 20956
Efr3a
Name: EFR3 homolog A
Synonyms: A130089M23Rik, D030063F01Rik, C920006C10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76740
Homologene: 44222
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 2 at 36,479,380 bp
  • T to A, chromosome 2 at 52,165,189 bp
  • A to G, chromosome 2 at 101,642,059 bp
  • T to A, chromosome 2 at 121,375,049 bp
  • G to T, chromosome 2 at 177,475,545 bp
  • CCAGATTCATGTAGCA to CCA, chromosome 3 at 36,964,932 bp
  • T to A, chromosome 3 at 136,868,720 bp
  • G to A, chromosome 4 at 33,248,057 bp
  • T to A, chromosome 5 at 6,771,124 bp
  • T to C, chromosome 5 at 125,287,383 bp
  • C to T, chromosome 5 at 139,392,602 bp
  • A to T, chromosome 7 at 18,647,298 bp
  • A to T, chromosome 7 at 25,615,724 bp
  • G to A, chromosome 7 at 42,475,188 bp
  • A to C, chromosome 7 at 44,055,726 bp
  • A to G, chromosome 7 at 44,461,807 bp
  • A to T, chromosome 7 at 45,146,225 bp
  • A to G, chromosome 7 at 55,873,462 bp
  • T to A, chromosome 7 at 101,999,285 bp
  • G to A, chromosome 8 at 12,396,955 bp
  • G to A, chromosome 8 at 33,269,054 bp
  • A to T, chromosome 9 at 7,507,283 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCAGCA, chromosome 9 at 46,212,057 bp
  • T to C, chromosome 9 at 70,812,901 bp
  • G to T, chromosome 9 at 106,075,390 bp
  • A to C, chromosome 10 at 41,256,466 bp
  • T to A, chromosome 10 at 52,154,934 bp
  • C to A, chromosome 10 at 74,385,901 bp
  • T to C, chromosome 10 at 80,606,820 bp
  • A to G, chromosome 11 at 3,863,414 bp
  • A to T, chromosome 11 at 50,923,309 bp
  • T to A, chromosome 11 at 76,273,993 bp
  • T to C, chromosome 11 at 100,414,043 bp
  • C to T, chromosome 13 at 27,126,017 bp
  • T to G, chromosome 13 at 33,930,047 bp
  • T to C, chromosome 13 at 60,176,034 bp
  • T to C, chromosome 14 at 70,310,117 bp
  • T to A, chromosome 15 at 25,737,971 bp
  • T to C, chromosome 15 at 42,676,268 bp
  • G to A, chromosome 15 at 65,829,830 bp
  • G to A, chromosome 15 at 79,054,050 bp
  • A to G, chromosome 16 at 32,619,167 bp
  • T to G, chromosome 16 at 36,898,721 bp
  • C to T, chromosome 16 at 44,219,779 bp
  • A to T, chromosome 16 at 45,442,554 bp
  • A to T, chromosome 17 at 46,540,311 bp
  • A to T, chromosome 17 at 58,162,250 bp
  • C to T, chromosome 17 at 78,866,403 bp
  • A to G, chromosome 18 at 12,168,871 bp
  • C to A, chromosome 18 at 37,336,312 bp
  • T to C, chromosome 19 at 13,445,621 bp
  • C to A, chromosome 19 at 17,122,674 bp
  • T to A, chromosome 19 at 40,765,357 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7830 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045884-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.