Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7830Btlr/Mmmh
Stock Number:
045884-MU
Citation ID:
RRID:MMRRC_045884-MU
Other Names:
R7830 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Serpinb6a
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonyms: Spi3, ovalbumin, D330015H01Rik, 4930482L21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20719
HGNC: HGNC:8950
Homologene: 20956
Efr3a
Name: EFR3 homolog A
Synonyms: A130089M23Rik, D030063F01Rik, C920006C10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76740
Homologene: 44222
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Sik3
Name: SIK family kinase 3
Synonyms: 5730525O22Rik, 9030204A07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70661
Homologene: 57023
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Aldh16a1
Name: aldehyde dehydrogenase 16 family, member A1
Synonyms: 2410004H02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69748
Homologene: 34938
Rag1
Name: recombination activating 1
Synonyms: Rag-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19373
HGNC: HGNC:9831
Homologene: 387
Lipc
Name: lipase, hepatic
Synonyms: HL, Hpl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15450
VEGA: 9
HGNC: HGNC:6619
Homologene: 199
Tfrc
Name: transferrin receptor
Synonyms: CD71, Mtvr-1, Mtvr1, E430033M20Rik, 2610028K12Rik, p90, Trfr, TfR1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22042
Homologene: 2429
Slc39a14
Name: solute carrier family 39 (zinc transporter), member 14
Synonyms: G630015O18Rik, Zip14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 213053
Homologene: 15037
Gas1
Name: growth arrest specific 1
Synonyms: Gas-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14451
HGNC: HGNC:4165
Homologene: 1548
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Ppp3ca
Name: protein phosphatase 3, catalytic subunit, alpha isoform
Synonyms: PP2B alpha 1, PP2BA alpha, CnA, Caln, Calna, 2900074D19Rik, CN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19055
HGNC: HGNC:9314
Homologene: 55497
Nxn
Name: nucleoredoxin
Synonyms: l11Jus13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18230
Homologene: 69028
Usf3
Name: upstream transcription factor family member 3
Synonyms: LOC207806, LOC385650, 5530400K22Rik, Gm608
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207806
Homologene: 19504
Fig4
Name: FIG4 phosphoinositide 5-phosphatase
Synonyms: A530089I17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103199
VEGA: 10
Homologene: 6713
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Strc
Name: stereocilin
Synonyms: DFNB16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140476
Homologene: 15401
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207618
Homologene: 52304
Osbp2
Name: oxysterol binding protein 2
Synonyms: OSBPL1, ORP-4, 1700095P05Rik, C630001G20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74309
HGNC: HGNC:8504
Homologene: 75303
Eif2ak2
Name: eukaryotic translation initiation factor 2-alpha kinase 2
Synonyms: eIF-2 alpha, Pkr, dsRNA-activated kinase, IFN- type I-induced and dsRNA-activated kinase, IFN-induced and double-stranded RNA-activated kinase, Prkr, Tik, eIF-2 alpha, 4732414G15Rik, 2310047A08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19106
HGNC: HGNC:9437
Homologene: 48134
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: EG235580, 1110001D15Rik, Dvwa, Vwa6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Psg21
Name: pregnancy-specific beta-1-glycoprotein 21
Synonyms: cea8, 1600019C01Rik, 1600026N13Rik, 1600025N01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72242
Homologene: 110989
Rmc1
Name: regulator of MON1-CCZ1
Synonyms: 3110002H16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 76482
Homologene: 8341
Lrrc4b
Name: leucine rich repeat containing 4B
Synonyms: Lrig4, NGL-3, Ngl3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 272381
Homologene: 45681
Angpt1
Name: angiopoietin 1
Synonyms: Ang-1, Angiopoietin-1, 1110046O21Rik, ang1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11600
VEGA: 15
HGNC: HGNC:484
Homologene: 37447
Or5b116
Name: olfactory receptor family 5 subfamily B member 116
Synonyms: GA_x6K02T2RE5P-3777626-3778570, MOR202-38, MOR202-47_p, Olfr1471
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258231
Homologene: 79417
Sox1
Name: SRY (sex determining region Y)-box 1
Synonyms: Sox-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20664
Homologene: 133765
Cd200l1
Name: CD200 molecule like 1
Synonyms: LOC208166, LOC385647, Gm609, iSEC1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208166
Homologene: 86707
Pcdhb6
Name: protocadherin beta 6
Synonyms: Pcdhb5B, PcdhbF
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93877
HGNC: HGNC:8690
Homologene: 62177
Klk1b27
Name: kallikrein 1-related peptidase b27
Synonyms: mGK-27, Klk27, Klk21l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16619
HGNC: HGNC:6357
Homologene: 68141
Ankrd54
Name: ankyrin repeat domain 54
Synonyms: C730048E16Rik, Liar
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223690
Homologene: 16352
Gpr146
Name: G protein-coupled receptor 146
Synonyms: PGR8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80290
Homologene: 36472
Or1j13
Name: olfactory receptor family 1 subfamily J member 13
Synonyms: GA_x6K02T2NLDC-33174915-33173974, MOR136-2, Olfr341
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258952
Homologene: 74160
Prl3d2
Name: prolactin family 3, subfamily d, member 2
Synonyms: PL-Ib, Plib
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 215028
Homologene: 137215
Erich4
Name: glutamate rich 4
Synonyms: Gm7092
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 632778
Homologene: 86877
Zfp354b
Name: zinc finger protein 354B
Synonyms: Kid2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27274
Homologene: 32187
Pnrc1
Name: proline-rich nuclear receptor coactivator 1
Synonyms: 5730463C12Rik, B4-2, PRR2, Prol2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 108767
Homologene: 4960
Zfp970
Name: zinc finger protein 970
Synonyms: Gm14420
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 628308
Homologene: 134324
Adat3
Name: adenosine deaminase, tRNA-specific 3
Synonyms: A430024H01Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100113398
VEGA: 10
Homologene: 50671
P3h4
Name: prolyl 3-hydroxylase family member 4 (non-enzymatic)
Synonyms: 1110036O03Rik, Leprel4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66180
Homologene: 4713
Cc2d2b
Name: coiled-coil and C2 domain containing 2B
Synonyms: EG668310
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668310
Homologene: 141114
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 2 at 36,479,380 bp
  • T to A, chromosome 2 at 52,165,189 bp
  • A to G, chromosome 2 at 101,642,059 bp
  • T to A, chromosome 2 at 121,375,049 bp
  • G to T, chromosome 2 at 177,475,545 bp
  • CCAGATTCATGTAGCA to CCA, chromosome 3 at 36,964,932 bp
  • T to A, chromosome 3 at 136,868,720 bp
  • G to A, chromosome 4 at 33,248,057 bp
  • T to A, chromosome 5 at 6,771,124 bp
  • T to C, chromosome 5 at 125,287,383 bp
  • C to T, chromosome 5 at 139,392,602 bp
  • A to T, chromosome 7 at 18,647,298 bp
  • A to T, chromosome 7 at 25,615,724 bp
  • G to A, chromosome 7 at 42,475,188 bp
  • A to C, chromosome 7 at 44,055,726 bp
  • A to G, chromosome 7 at 44,461,807 bp
  • A to T, chromosome 7 at 45,146,225 bp
  • A to G, chromosome 7 at 55,873,462 bp
  • T to A, chromosome 7 at 101,999,285 bp
  • G to A, chromosome 8 at 12,396,955 bp
  • G to A, chromosome 8 at 33,269,054 bp
  • A to T, chromosome 9 at 7,507,283 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCAGCA, chromosome 9 at 46,212,057 bp
  • T to C, chromosome 9 at 70,812,901 bp
  • G to T, chromosome 9 at 106,075,390 bp
  • A to C, chromosome 10 at 41,256,466 bp
  • T to A, chromosome 10 at 52,154,934 bp
  • C to A, chromosome 10 at 74,385,901 bp
  • T to C, chromosome 10 at 80,606,820 bp
  • A to G, chromosome 11 at 3,863,414 bp
  • A to T, chromosome 11 at 50,923,309 bp
  • T to A, chromosome 11 at 76,273,993 bp
  • T to C, chromosome 11 at 100,414,043 bp
  • C to T, chromosome 13 at 27,126,017 bp
  • T to G, chromosome 13 at 33,930,047 bp
  • T to C, chromosome 13 at 60,176,034 bp
  • T to C, chromosome 14 at 70,310,117 bp
  • T to A, chromosome 15 at 25,737,971 bp
  • T to C, chromosome 15 at 42,676,268 bp
  • G to A, chromosome 15 at 65,829,830 bp
  • G to A, chromosome 15 at 79,054,050 bp
  • A to G, chromosome 16 at 32,619,167 bp
  • T to G, chromosome 16 at 36,898,721 bp
  • C to T, chromosome 16 at 44,219,779 bp
  • A to T, chromosome 16 at 45,442,554 bp
  • A to T, chromosome 17 at 46,540,311 bp
  • A to T, chromosome 17 at 58,162,250 bp
  • C to T, chromosome 17 at 78,866,403 bp
  • A to G, chromosome 18 at 12,168,871 bp
  • C to A, chromosome 18 at 37,336,312 bp
  • T to C, chromosome 19 at 13,445,621 bp
  • C to A, chromosome 19 at 17,122,674 bp
  • T to A, chromosome 19 at 40,765,357 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7830 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045884-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.