Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7841Btlr/Mmmh
Stock Number:
045895-MU
Citation ID:
RRID:MMRRC_045895-MU
Other Names:
R7841 (G1)
Major Collection:

Strain Information

Npr1
Name: natriuretic peptide receptor 1
Synonyms: NPRA, GC-A, NPR-A, guanylyl cyclase-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Ccnd1
Name: cyclin D1
Synonyms: Cyl-1, bcl-1, PRAD1, cD1, CycD1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12443
HGNC: HGNC:1582
Homologene: 1334
Cyp19a1
Name: cytochrome P450, family 19, subfamily a, polypeptide 1
Synonyms: Int-5, Int5, aromatase, Ar, Cyp19, ArKO, p450arom
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13075
VEGA: 9
HGNC: HGNC:2594
Homologene: 30955
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Hspa4
Name: heat shock protein 4
Synonyms: APG-2, Hsp70RY, Hsp110, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15525
HGNC: HGNC:5237
Homologene: 1624
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 40,105,468 bp
  • T to C, chromosome 1 at 58,447,883 bp
  • A to T, chromosome 1 at 90,059,615 bp
  • T to C, chromosome 1 at 106,743,685 bp
  • T to C, chromosome 2 at 76,832,146 bp
  • C to A, chromosome 2 at 89,721,965 bp
  • T to A, chromosome 2 at 104,059,992 bp
  • T to C, chromosome 2 at 113,529,465 bp
  • T to C, chromosome 2 at 121,342,795 bp
  • C to A, chromosome 2 at 127,236,834 bp
  • G to A, chromosome 2 at 148,771,307 bp
  • T to A, chromosome 2 at 152,932,987 bp
  • T to C, chromosome 2 at 181,232,902 bp
  • A to T, chromosome 3 at 90,454,868 bp
  • T to A, chromosome 3 at 92,572,392 bp
  • A to T, chromosome 3 at 101,060,810 bp
  • A to T, chromosome 3 at 107,476,898 bp
  • A to T, chromosome 3 at 116,546,097 bp
  • A to T, chromosome 3 at 124,321,704 bp
  • G to T, chromosome 3 at 124,321,705 bp
  • A to G, chromosome 4 at 21,958,584 bp
  • G to A, chromosome 4 at 152,496,683 bp
  • T to C, chromosome 5 at 87,250,630 bp
  • T to C, chromosome 5 at 103,654,940 bp
  • T to A, chromosome 5 at 137,436,802 bp
  • T to A, chromosome 6 at 8,737,072 bp
  • T to C, chromosome 6 at 34,745,761 bp
  • A to G, chromosome 6 at 35,247,437 bp
  • G to A, chromosome 6 at 118,155,360 bp
  • A to G, chromosome 7 at 16,115,634 bp
  • A to G, chromosome 7 at 25,285,767 bp
  • A to AAGGCGACGG, chromosome 7 at 97,579,904 bp
  • T to A, chromosome 7 at 104,924,859 bp
  • A to G, chromosome 7 at 105,762,973 bp
  • G to T, chromosome 7 at 107,794,091 bp
  • A to C, chromosome 7 at 121,648,456 bp
  • A to T, chromosome 7 at 121,677,312 bp
  • A to T, chromosome 7 at 144,937,981 bp
  • AACGC to A, chromosome 8 at 56,540,983 bp
  • G to A, chromosome 8 at 104,309,476 bp
  • A to G, chromosome 8 at 104,835,060 bp
  • A to G, chromosome 9 at 3,634,766 bp
  • T to G, chromosome 9 at 38,190,481 bp
  • T to A, chromosome 9 at 38,309,521 bp
  • A to C, chromosome 9 at 50,610,416 bp
  • A to T, chromosome 9 at 54,171,805 bp
  • T to C, chromosome 9 at 87,244,316 bp
  • A to G, chromosome 9 at 107,561,545 bp
  • T to C, chromosome 10 at 27,155,533 bp
  • A to G, chromosome 10 at 34,298,271 bp
  • T to A, chromosome 10 at 130,497,226 bp
  • A to T, chromosome 11 at 6,601,031 bp
  • G to T, chromosome 11 at 12,253,324 bp
  • C to A, chromosome 11 at 26,471,457 bp
  • G to A, chromosome 11 at 53,267,060 bp
  • A to G, chromosome 11 at 61,506,366 bp
  • A to G, chromosome 11 at 67,098,692 bp
  • A to G, chromosome 11 at 69,899,286 bp
  • A to T, chromosome 11 at 99,022,350 bp
  • A to T, chromosome 11 at 103,501,105 bp
  • T to C, chromosome 12 at 69,204,258 bp
  • G to T, chromosome 12 at 113,545,458 bp
  • G to A, chromosome 13 at 85,189,593 bp
  • G to T, chromosome 14 at 50,345,828 bp
  • A to G, chromosome 14 at 103,146,831 bp
  • T to A, chromosome 14 at 122,562,972 bp
  • T to C, chromosome 14 at 123,972,233 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to C, chromosome 15 at 37,980,906 bp
  • T to A, chromosome 15 at 55,382,480 bp
  • T to C, chromosome 15 at 79,089,579 bp
  • A to T, chromosome 15 at 102,147,917 bp
  • G to A, chromosome 17 at 6,044,144 bp
  • A to G, chromosome 17 at 20,470,043 bp
  • A to T, chromosome 17 at 25,948,484 bp
  • TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG to TTGCTGCTG, chromosome 17 at 50,799,922 bp
  • T to C, chromosome 17 at 63,487,825 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7841 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045895-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.