Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7859Btlr/Mmmh
Stock Number:
045912-MU
Citation ID:
RRID:MMRRC_045912-MU
Other Names:
R7859 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Crkl
Name: v-crk avian sarcoma virus CT10 oncogene homolog-like
Synonyms: 1110025F07Rik, Crkol, snoop
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12929
HGNC: HGNC:2363
Homologene: 38021
Cemip2
Name: cell migration inducing hyaluronidase 2
Synonyms: 3110012M15Rik, Tmem2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83921
VEGA: 19
Homologene: 75008
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Dmtf1
Name: cyclin D binding myb like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23857
Homologene: 8017
Atxn10
Name: ataxin 10
Synonyms: TEG-169, E46, Sca10, Tex169
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54138
VEGA: 15
Homologene: 40858
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 11,080,050 bp
  • T to A, chromosome 2 at 24,421,555 bp
  • T to C, chromosome 2 at 84,856,876 bp
  • A to G, chromosome 2 at 147,177,810 bp
  • T to C, chromosome 3 at 122,949,766 bp
  • A to C, chromosome 4 at 108,848,246 bp
  • G to T, chromosome 4 at 108,848,247 bp
  • T to C, chromosome 5 at 9,128,044 bp
  • T to A, chromosome 6 at 40,740,179 bp
  • A to T, chromosome 6 at 124,224,242 bp
  • G to A, chromosome 6 at 137,392,807 bp
  • A to T, chromosome 7 at 18,426,224 bp
  • T to C, chromosome 7 at 55,900,026 bp
  • A to T, chromosome 7 at 139,920,964 bp
  • G to A, chromosome 7 at 141,645,420 bp
  • GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,042,160 bp
  • T to A, chromosome 8 at 67,501,350 bp
  • G to T, chromosome 10 at 5,157,683 bp
  • T to A, chromosome 10 at 6,890,569 bp
  • T to C, chromosome 10 at 23,961,134 bp
  • T to C, chromosome 11 at 67,186,700 bp
  • T to C, chromosome 11 at 79,527,626 bp
  • T to G, chromosome 11 at 80,684,377 bp
  • T to C, chromosome 11 at 114,893,339 bp
  • T to A, chromosome 12 at 30,100,574 bp
  • G to A, chromosome 12 at 108,826,830 bp
  • T to A, chromosome 12 at 113,088,483 bp
  • A to C, chromosome 13 at 25,262,271 bp
  • A to C, chromosome 13 at 30,708,754 bp
  • G to A, chromosome 13 at 43,560,009 bp
  • T to A, chromosome 13 at 51,722,351 bp
  • A to G, chromosome 13 at 67,306,381 bp
  • T to A, chromosome 13 at 93,862,107 bp
  • T to C, chromosome 14 at 20,588,136 bp
  • G to A, chromosome 14 at 55,522,125 bp
  • A to T, chromosome 15 at 57,250,952 bp
  • A to G, chromosome 15 at 85,462,325 bp
  • T to A, chromosome 16 at 17,469,096 bp
  • A to G, chromosome 17 at 18,061,950 bp
  • G to T, chromosome 17 at 20,541,174 bp
  • T to C, chromosome 17 at 24,384,526 bp
  • T to A, chromosome 17 at 24,571,280 bp
  • A to G, chromosome 17 at 70,516,688 bp
  • T to A, chromosome 19 at 12,919,982 bp
  • T to A, chromosome 19 at 21,832,175 bp
  • G to A, chromosome 19 at 25,183,570 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7859 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045912-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.