Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7870Btlr/Mmmh
Stock Number:
045922-MU
Citation ID:
RRID:MMRRC_045922-MU
Other Names:
R7870 (G1)
Major Collection:

Strain Information

Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Pcdh9
Name: protocadherin 9
Synonyms: C630029H24Rik, 1500001L12Rik, LOC382930, A730003J17Rik, C530050I23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211712
HGNC: HGNC:8661
Homologene: 10698
Kcnj1
Name: potassium inwardly-rectifying channel, subfamily J, member 1
Synonyms: ROMK-2, ROMK, Kir1.1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56379
VEGA: 9
HGNC: HGNC:6255
Homologene: 56764
Alox12b
Name: arachidonate 12-lipoxygenase, 12R type
Synonyms: e-LOX2, Aloxe2, 12R-LOX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11686
HGNC: HGNC:430
Homologene: 884
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Stau1
Name: staufen double-stranded RNA binding protein 1
Synonyms: 5830401L18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20853
Homologene: 3384
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, Mib, skeletrophin, mind bomb-1, mindbomb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 40,491,136 bp
  • T to A, chromosome 1 at 44,210,211 bp
  • T to A, chromosome 1 at 118,199,155 bp
  • A to T, chromosome 1 at 180,811,925 bp
  • A to G, chromosome 2 at 27,062,286 bp
  • G to A, chromosome 2 at 52,325,749 bp
  • A to T, chromosome 2 at 118,115,027 bp
  • G to T, chromosome 2 at 166,950,950 bp
  • A to G, chromosome 2 at 181,996,113 bp
  • G to T, chromosome 4 at 98,424,316 bp
  • T to A, chromosome 4 at 106,654,079 bp
  • T to A, chromosome 5 at 34,898,547 bp
  • C to A, chromosome 5 at 48,302,307 bp
  • T to C, chromosome 5 at 90,472,629 bp
  • T to G, chromosome 5 at 112,438,581 bp
  • G to C, chromosome 5 at 137,735,396 bp
  • A to G, chromosome 6 at 3,968,281 bp
  • G to T, chromosome 6 at 23,263,642 bp
  • C to T, chromosome 6 at 29,454,307 bp
  • G to A, chromosome 6 at 86,392,341 bp
  • A to T, chromosome 6 at 136,617,328 bp
  • C to T, chromosome 7 at 21,162,267 bp
  • C to A, chromosome 7 at 35,211,497 bp
  • T to C, chromosome 7 at 100,010,042 bp
  • T to A, chromosome 7 at 103,598,266 bp
  • A to G, chromosome 7 at 111,052,411 bp
  • A to G, chromosome 7 at 126,492,752 bp
  • G to A, chromosome 7 at 127,560,558 bp
  • G to A, chromosome 9 at 32,396,585 bp
  • A to C, chromosome 9 at 40,100,677 bp
  • T to A, chromosome 10 at 100,605,643 bp
  • C to A, chromosome 10 at 127,776,697 bp
  • TGTCACACTCG to TG, chromosome 11 at 50,815,238 bp
  • T to C, chromosome 11 at 52,018,457 bp
  • T to C, chromosome 11 at 59,438,078 bp
  • T to C, chromosome 11 at 69,169,309 bp
  • T to C, chromosome 11 at 77,453,615 bp
  • T to A, chromosome 11 at 116,649,290 bp
  • G to T, chromosome 12 at 72,486,190 bp
  • A to G, chromosome 13 at 52,968,413 bp
  • A to G, chromosome 14 at 26,856,529 bp
  • A to G, chromosome 14 at 31,172,095 bp
  • C to G, chromosome 14 at 54,988,801 bp
  • A to T, chromosome 14 at 93,887,257 bp
  • A to T, chromosome 15 at 23,474,327 bp
  • A to T, chromosome 15 at 32,609,339 bp
  • A to T, chromosome 15 at 58,787,161 bp
  • T to G, chromosome 15 at 97,884,890 bp
  • G to A, chromosome 16 at 58,999,723 bp
  • TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC to TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC, chromosome 16 at 91,656,598 bp
  • A to G, chromosome 17 at 24,679,330 bp
  • A to G, chromosome 17 at 25,860,539 bp
  • A to T, chromosome 17 at 36,978,017 bp
  • G to A, chromosome 18 at 10,798,446 bp
  • A to G, chromosome 18 at 31,720,661 bp
  • A to G, chromosome 18 at 65,938,213 bp
  • G to T, chromosome 19 at 18,815,241 bp
  • A to C, chromosome 19 at 39,609,225 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7870 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045922-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.