Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7871Btlr/Mmmh
Stock Number:
045923-MU
Citation ID:
RRID:MMRRC_045923-MU
Other Names:
R7871 (G1)
Major Collection:

Strain Information

Aatf
Name: apoptosis antagonizing transcription factor
Synonyms: 4933415H02Rik, Trb, 5830465M17Rik, Che-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56321
Homologene: 40811
Bmp7
Name: bone morphogenetic protein 7
Synonyms: osteogenic protein 1, OP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12162
HGNC: HGNC:1074
Homologene: 20410
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Glt8d1
Name: glycosyltransferase 8 domain containing 1
Synonyms: 5430414N14Rik, 2410004H05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76485
VEGA: 14
Homologene: 32720
Neurl4
Name: neuralized E3 ubiquitin protein ligase 4
Synonyms: 0610025P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216860
Homologene: 13029
Ipo11
Name: importin 11
Synonyms: E330021B14Rik, 1700081H05Rik, 2510001A17Rik, Ranbp11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76582
Homologene: 7089
Kntc1
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208628
Homologene: 32227
Asap1
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain1
Synonyms: Ddef1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13196
HGNC: HGNC:2720
Homologene: 7684
Cse1l
Name: chromosome segregation 1 like
Synonyms: Cas, Capts, 2610100P18Rik, Xpo2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110750
HGNC: HGNC:2431
Homologene: 1006
Rras2
Name: related RAS viral (r-ras) oncogene 2
Synonyms: 2610016H24Rik, TC21
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66922
Homologene: 6945
Mbd1
Name: methyl-CpG binding domain protein 1
Synonyms: PCM1, Cxxc3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17190
VEGA: 18
HGNC: HGNC:6916
Homologene: 8414
Cyfip2
Name: cytoplasmic FMR1 interacting protein 2
Synonyms: Pir121, 6430511D02Rik, 1500004I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76884
Homologene: 7936
N4bp2
Name: NEDD4 binding protein 2
Synonyms: LOC333789, LOC386488, B3bp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 333789
Homologene: 32396
Ccnh
Name: cyclin H
Synonyms: 6330408H09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66671
HGNC: HGNC:1594
Homologene: 946
Dennd1b
Name: DENN domain containing 1B
Synonyms: F730008N07Rik, 4632404N19Rik, 4930467M19Rik, 6820401H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329260
Homologene: 11739
Klk8
Name: kallikrein related-peptidase 8
Synonyms: BSP1, Prss19, Nrpn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259277
HGNC: HGNC:6369
Homologene: 21410
Hsd17b13
Name: hydroxysteroid (17-beta) dehydrogenase 13
Synonyms: Pan1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243168
Homologene: 71549
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Sptbn2
Name: spectrin beta, non-erythrocytic 2
Synonyms: Spnb3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20743
VEGA: 19
Homologene: 48482
Yme1l1
Name: YME1-like 1 (S. cerevisiae)
Synonyms: Ftsh, ATP-dependent metalloprotease FtsH1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27377
Homologene: 31996
Ncstn
Name: nicastrin
Synonyms: nicastrin, 9430068N19Rik, Nct, D1Dau13e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59287
Homologene: 41029
2900026A02Rik
Name: RIKEN cDNA 2900026A02 gene
Synonyms: LOC231620, Gm449
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243219
Homologene: 129566
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Slc44a4
Name: solute carrier family 44, member 4
Synonyms: NG22, 2210409B01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70129
Homologene: 11359
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Itpr-3, Ip3r3, tf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Skor1
Name: SKI family transcriptional corepressor 1
Synonyms: C230094B15Rik, Corl1, Lbxcor1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 207667
Homologene: 18175
Chst4
Name: carbohydrate sulfotransferase 4
Synonyms: high endothelial cell GlcNAC-6-sulphotransferase, HEC-GlcNAc6ST, GST-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26887
HGNC: HGNC:1972
Homologene: 4216
Cyp4f18
Name: cytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms: 1810054N16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72054
HGNC: HGNC:2646
Homologene: 128623
Entpd3
Name: ectonucleoside triphosphate diphosphohydrolase 3
Synonyms: NTPDase-3, HB6, Cd39l3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215446
HGNC: HGNC:3365
Homologene: 68171
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Pik3r4
Name: phosphoinositide-3-kinase regulatory subunit 4
Synonyms: Vps15, p150
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75669
HGNC: HGNC:8982
Homologene: 24678
Zfp629
Name: zinc finger protein 629
Synonyms: 9330199A09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320683
Homologene: 65318
Nadsyn1
Name: NAD synthetase 1
Synonyms: 9130012B15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78914
Homologene: 6098
Ppp1r9b
Name: protein phosphatase 1, regulatory subunit 9B
Synonyms: neurabin II, spinophilin, Spn, SPL
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217124
HGNC: HGNC:9298
Homologene: 32787
Or6c209
Name: olfactory receptor family 6 subfamily C member 209
Synonyms: GA_x6K02T2PULF-11325750-11326685, MOR114-2, Olfr799
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258929
Homologene: 37000
Topaz1
Name: testis and ovary specific PAZ domain containing 1
Synonyms: Gm9524
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 671232
VEGA: 9
Homologene: 19835
Sppl2c
Name: signal peptide peptidase 2C
Synonyms: 4933407P14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237958
Homologene: 18491
Map3k13
Name: mitogen-activated protein kinase kinase kinase 13
Synonyms: C130026N12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71751
VEGA: 16
HGNC: HGNC:6852
Homologene: 37958
Cyp2c39
Name: cytochrome P450, family 2, subfamily c, polypeptide 39
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13098
Homologene: 117948
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Nuggc
Name: nuclear GTPase, germinal center associated
Synonyms: LOC239151, Gm600, SLIP-GC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100503545
Homologene: 72641
Mep1a
Name: meprin 1 alpha
Synonyms: meprin A alpha-subunit, meprin alpha, Mep-1a, Mep-1, Mep1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17287
HGNC: HGNC:7015
Homologene: 31323
Ttbk1
Name: tau tubulin kinase 1
Synonyms: C330008L01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106763
VEGA: 17
Homologene: 50342
Fam171a1
Name: family with sequence similarity 171, member A1
Synonyms: 9630050M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269233
Homologene: 19521
Ccno
Name: cyclin O
Synonyms: Ung2, Ccnu
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218630
VEGA: 13
Homologene: 50171
Serpinb3c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms: 1110001H02Rik, 1110013A16Rik, ovalbumin, Serpinb4, Scca2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381286
Homologene: 131278
Mtrf1
Name: mitochondrial translational release factor 1
Synonyms: A830062K05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211253
VEGA: 14
HGNC: HGNC:7469
Homologene: 20903
Cntnap3
Name: contactin associated protein-like 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Chml
Name: choroideremia-like
Synonyms: Rep2, E030003F13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12663
HGNC: HGNC:1941
Homologene: 31055
Zfp709
Name: zinc finger protein 709
Synonyms: GIOT-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 236193
Homologene: 136795
Slc22a22
Name: solute carrier family 22 (organic cation transporter), member 22
Synonyms: OAT-PG, BC026439
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 210463
Homologene: 18166
Vmn2r109
Name: vomeronasal 2, receptor 109
Synonyms: EG627814
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627814
Homologene: 129678
Fam50b
Name: family with sequence similarity 50, member B
Synonyms: XAP-5-like, X5L, D0H6S2654E
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108161
VEGA: 13
Homologene: 101669
Vmn2r71
Name: vomeronasal 2, receptor 71
Synonyms: EG233445
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233445
Homologene: 115466
Stx5a
Name: syntaxin 5A
Synonyms: syntaxin 5, 0610031F24Rik, D19Ertd627e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56389
Homologene: 2381
Gstp3
Name: glutathione S-transferase pi 3
Synonyms: BC021614
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225884
HGNC: HGNC:4638
Homologene: 129928
Sh3bp2
Name: SH3-domain binding protein 2
Synonyms: 3BP2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24055
Homologene: 2276
Galntl6
Name: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms: 1700021K10Rik, 4930431L04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270049
Homologene: 65137
Cd70
Name: CD70 antigen
Synonyms: Ki-24 antigen, CD27LG, Tnfsf7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21948
VEGA: 17
Homologene: 956
Erg28
Name: ergosterol biosynthesis 28
Synonyms: ORF11, 0610007P14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 58520
HGNC: HGNC:1187
Homologene: 38284
Arpin
Name: actin-related protein 2/3 complex inhibitor
Synonyms: 2610034B18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70420
Homologene: 128480
Six4
Name: sine oculis-related homeobox 4
Synonyms: AREC3, TrexBF
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20474
Homologene: 69089
Gm28363
Name: predicted gene 28363
Type: Gene
Species: Mouse
Chromosome: 1
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 51,779,580 bp
  • T to A, chromosome 1 at 107,273,153 bp
  • A to T, chromosome 1 at 117,697,498 bp
  • C to A, chromosome 1 at 132,600,013 bp
  • G to A, chromosome 1 at 139,062,873 bp
  • T to C, chromosome 1 at 172,075,456 bp
  • CTGTTTG to CTG, chromosome 1 at 175,687,400 bp
  • A to G, chromosome 2 at 3,225,384 bp
  • A to G, chromosome 2 at 23,181,065 bp
  • T to C, chromosome 2 at 76,717,215 bp
  • T to C, chromosome 2 at 76,748,145 bp
  • T to C, chromosome 2 at 76,965,137 bp
  • T to A, chromosome 2 at 166,935,671 bp
  • C to A, chromosome 2 at 172,939,991 bp
  • T to C, chromosome 2 at 181,321,029 bp
  • T to A, chromosome 4 at 134,087,599 bp
  • A to G, chromosome 5 at 34,559,085 bp
  • T to C, chromosome 5 at 34,864,649 bp
  • A to G, chromosome 5 at 65,807,103 bp
  • A to G, chromosome 5 at 103,965,815 bp
  • T to A, chromosome 5 at 109,943,299 bp
  • A to G, chromosome 5 at 113,183,226 bp
  • T to A, chromosome 5 at 123,784,227 bp
  • A to G, chromosome 7 at 43,799,326 bp
  • A to T, chromosome 7 at 79,927,715 bp
  • A to T, chromosome 7 at 85,623,661 bp
  • A to T, chromosome 7 at 87,314,127 bp
  • G to A, chromosome 7 at 114,117,548 bp
  • T to A, chromosome 7 at 119,967,552 bp
  • A to G, chromosome 7 at 127,611,995 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • T to A, chromosome 7 at 143,798,496 bp
  • T to C, chromosome 8 at 57,837,188 bp
  • A to G, chromosome 8 at 71,889,464 bp
  • G to A, chromosome 8 at 71,988,643 bp
  • A to G, chromosome 8 at 110,030,913 bp
  • T to C, chromosome 9 at 63,146,501 bp
  • T to C, chromosome 9 at 105,663,117 bp
  • A to G, chromosome 9 at 120,560,586 bp
  • A to G, chromosome 9 at 122,780,700 bp
  • A to G, chromosome 10 at 129,647,412 bp
  • T to C, chromosome 11 at 46,242,350 bp
  • T to C, chromosome 11 at 69,903,186 bp
  • ACACACACACACACACACACACACACACACACACACACACACACACACAC to ACACACACACACACACACACACACACACACACACACACACACACACACACAC, chromosome 11 at 84,471,038 bp
  • T to C, chromosome 11 at 95,001,909 bp
  • A to G, chromosome 11 at 104,188,516 bp
  • CT to C, chromosome 12 at 73,104,239 bp
  • G to A, chromosome 12 at 85,819,479 bp
  • T to A, chromosome 13 at 13,636,052 bp
  • G to A, chromosome 13 at 34,747,101 bp
  • A to C, chromosome 13 at 64,903,773 bp
  • T to A, chromosome 13 at 85,211,872 bp
  • T to C, chromosome 13 at 106,892,468 bp
  • C to A, chromosome 13 at 112,988,113 bp
  • A to T, chromosome 14 at 31,010,339 bp
  • A to G, chromosome 14 at 65,623,251 bp
  • A to G, chromosome 14 at 79,406,938 bp
  • T to A, chromosome 15 at 57,263,355 bp
  • A to G, chromosome 15 at 64,092,076 bp
  • A to G, chromosome 16 at 21,921,596 bp
  • C to T, chromosome 16 at 32,754,935 bp
  • T to C, chromosome 17 at 20,540,520 bp
  • T to A, chromosome 17 at 27,117,179 bp
  • T to A, chromosome 17 at 34,923,852 bp
  • T to C, chromosome 17 at 43,479,235 bp
  • T to A, chromosome 17 at 46,446,238 bp
  • T to G, chromosome 17 at 57,148,770 bp
  • A to G, chromosome 18 at 22,524,224 bp
  • G to A, chromosome 18 at 74,274,057 bp
  • T to A, chromosome 19 at 4,058,746 bp
  • C to G, chromosome 19 at 4,749,012 bp
  • T to A, chromosome 19 at 8,755,118 bp
  • T to C, chromosome 19 at 39,560,961 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7871 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045923-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text