Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7899Btlr/Mmmh
Stock Number:
045951-MU
Citation ID:
RRID:MMRRC_045951-MU
Other Names:
R7899 (G1)
Major Collection:

Strain Information

Trp53
Name: transformation related protein 53
Synonyms: p53, p44
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22059
Homologene: 460
Kcnc1
Name: potassium voltage gated channel, Shaw-related subfamily, member 1
Synonyms: Kv3.1, KV4, NGK2, KShIIIB, Kcr2-1, Shaw, C230009H10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16502
HGNC: HGNC:6233
Homologene: 68134
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Orc1
Name: origin recognition complex, subunit 1
Synonyms: MmORC1, Orc1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18392
HGNC: HGNC:8487
Homologene: 31221
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Topors
Name: topoisomerase I binding, arginine/serine-rich
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 106021
Homologene: 4237
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 16,677,044 bp
  • A to T, chromosome 1 at 34,469,905 bp
  • A to T, chromosome 1 at 46,514,701 bp
  • A to G, chromosome 1 at 58,281,237 bp
  • A to T, chromosome 1 at 90,941,763 bp
  • G to C, chromosome 1 at 93,274,082 bp
  • T to A, chromosome 1 at 175,978,641 bp
  • T to A, chromosome 1 at 191,621,315 bp
  • T to C, chromosome 2 at 4,604,089 bp
  • A to G, chromosome 2 at 65,125,931 bp
  • T to C, chromosome 2 at 85,438,397 bp
  • A to T, chromosome 2 at 112,646,950 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • A to T, chromosome 2 at 180,671,597 bp
  • A to C, chromosome 3 at 53,461,659 bp
  • T to A, chromosome 3 at 67,473,527 bp
  • T to A, chromosome 3 at 72,937,251 bp
  • T to C, chromosome 3 at 88,621,262 bp
  • C to A, chromosome 3 at 96,170,428 bp
  • T to A, chromosome 3 at 122,282,369 bp
  • T to G, chromosome 3 at 122,508,253 bp
  • G to C, chromosome 4 at 40,260,356 bp
  • A to G, chromosome 4 at 94,621,977 bp
  • T to G, chromosome 4 at 108,603,371 bp
  • A to G, chromosome 4 at 124,914,835 bp
  • G to A, chromosome 4 at 137,548,116 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • C to T, chromosome 5 at 27,721,079 bp
  • G to T, chromosome 5 at 38,213,930 bp
  • A to G, chromosome 5 at 48,247,185 bp
  • A to G, chromosome 5 at 57,719,810 bp
  • C to A, chromosome 5 at 71,657,995 bp
  • G to A, chromosome 5 at 72,524,215 bp
  • C to T, chromosome 5 at 88,008,227 bp
  • T to C, chromosome 5 at 114,809,320 bp
  • C to A, chromosome 5 at 135,737,198 bp
  • A to C, chromosome 5 at 145,220,866 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to T, chromosome 6 at 149,041,661 bp
  • A to G, chromosome 7 at 14,465,209 bp
  • G to A, chromosome 7 at 35,429,928 bp
  • T to A, chromosome 7 at 46,427,821 bp
  • T to C, chromosome 7 at 79,669,485 bp
  • T to A, chromosome 7 at 116,521,970 bp
  • A to G, chromosome 8 at 77,597,811 bp
  • G to A, chromosome 8 at 84,594,173 bp
  • A to T, chromosome 8 at 110,587,748 bp
  • T to G, chromosome 9 at 8,903,742 bp
  • T to C, chromosome 9 at 18,640,697 bp
  • C to T, chromosome 9 at 58,290,834 bp
  • T to C, chromosome 9 at 63,616,850 bp
  • A to T, chromosome 10 at 5,227,956 bp
  • A to G, chromosome 10 at 82,282,897 bp
  • A to G, chromosome 10 at 86,064,929 bp
  • C to A, chromosome 10 at 112,165,761 bp
  • C to A, chromosome 11 at 56,040,335 bp
  • T to C, chromosome 11 at 69,590,693 bp
  • C to A, chromosome 11 at 106,252,289 bp
  • T to C, chromosome 11 at 114,738,630 bp
  • A to C, chromosome 12 at 28,595,282 bp
  • A to G, chromosome 12 at 78,197,422 bp
  • C to A, chromosome 12 at 100,878,448 bp
  • A to G, chromosome 12 at 104,038,265 bp
  • G to T, chromosome 13 at 31,558,995 bp
  • A to T, chromosome 14 at 6,218,220 bp
  • A to T, chromosome 15 at 8,119,179 bp
  • A to G, chromosome 15 at 34,123,719 bp
  • A to G, chromosome 15 at 89,068,733 bp
  • G to T, chromosome 17 at 24,702,484 bp
  • TCAGGGTGGGGGTAGAGCCTGAGCCACTGCTAGATGCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAG to TCAGGGTGGGGGTAGAGCCTGAG, chromosome 17 at 35,620,601 bp
  • T to C, chromosome 18 at 10,000,563 bp
  • A to G, chromosome 18 at 35,734,573 bp
  • G to C, chromosome 18 at 37,670,857 bp
  • A to G, chromosome 18 at 44,354,184 bp
  • A to T, chromosome 18 at 90,527,874 bp
  • A to T, chromosome 19 at 3,899,104 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7899 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045951-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.