Strain Name:
C57BL/6J-MtgxR7899Btlr/Mmmh
Stock Number:
045951-MU
Citation ID:
RRID:MMRRC_045951-MU
Other Names:
R7899 (G1)
Major Collection:

Strain Information

Trp53
Name: transformation related protein 53
Synonyms: p53, p44
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22059
Homologene: 460
Kcnc1
Name: potassium voltage gated channel, Shaw-related subfamily, member 1
Synonyms: Kv3.1, KV4, NGK2, KShIIIB, Kcr2-1, Shaw, C230009H10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16502
HGNC: HGNC:6233
Homologene: 68134
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Orc1
Name: origin recognition complex, subunit 1
Synonyms: MmORC1, Orc1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18392
HGNC: HGNC:8487
Homologene: 31221
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Topors
Name: topoisomerase I binding, arginine/serine-rich
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 106021
Homologene: 4237
Usp14
Name: ubiquitin specific peptidase 14
Synonyms: dUB-type TGT, 2610005K12Rik, ataxia, ax, NMF375, 2610037B11Rik, nmf375
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 59025
Homologene: 3780
Ticrr
Name: TOPBP1-interacting checkpoint and replication regulator
Synonyms: 5730590G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77011
Homologene: 67120
Dido1
Name: death inducer-obliterator 1
Synonyms: DIO-1, 6720461J16Rik, D130048F08Rik, Datf1, dido, C130092D22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23856
HGNC: HGNC:2680
Homologene: 34139
Mtdh
Name: metadherin
Synonyms: D8Bwg1112e, 3D3/Lyric, Lyric, 2610103J23Rik, AEG-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67154
Homologene: 12089
Taf4
Name: TATA-box binding protein associated factor 4
Synonyms: TAFII135, TAFII130, Taf2c1, Taf4a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228980
Homologene: 55723
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Syn3
Name: synapsin III
Synonyms: Synapsin IIIa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27204
Homologene: 68320
Zkscan5
Name: zinc finger with KRAB and SCAN domains 5
Synonyms: hKraba1, Zfp95
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22757
Homologene: 8734
Dnttip2
Name: deoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms: 4930588M11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99480
Homologene: 124162
Ift74
Name: intraflagellar transport 74
Synonyms: 1700029H06Rik, Cmg1, Ccdc2, b2b796Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67694
Homologene: 11831
Pgr
Name: progesterone receptor
Synonyms: PR, NR3C3, 9930019P03Rik, PR-B, PR-A, ENSMUSG00000074510
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18667
HGNC: HGNC:8910
Homologene: 713
Slit2
Name: slit guidance ligand 2
Synonyms: Slil3, Drad-1, E130320P19Rik, E030015M03Rik, b2b1200.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20563
Homologene: 3516
Gpr68
Name: G protein-coupled receptor 68
Synonyms: OGR1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238377
HGNC: HGNC:4519
Homologene: 2603
Colec11
Name: collectin sub-family member 11
Synonyms: 1010001H16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71693
VEGA: 12
Homologene: 11423
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Arhgef2
Name: Rho/Rac guanine nucleotide exchange factor 2
Synonyms: Lfc, GEF-H1, LFP40, GEFH1, P40, Lbcl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16800
HGNC: HGNC:682
Homologene: 3468
Aagab
Name: alpha- and gamma-adaptin binding protein
Synonyms: 2310007F21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66939
VEGA: 9
Homologene: 11648
Ints7
Name: integrator complex subunit 7
Synonyms: 5930412E23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77065
Homologene: 9136
Tbl3
Name: transducin (beta)-like 3
Synonyms: 9430070M15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213773
Homologene: 4711
Nhlrc3
Name: NHL repeat containing 3
Synonyms: 8030451K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 212114
Homologene: 35239
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Dennd5b
Name: DENN domain containing 5B
Synonyms: 9330160C06Rik, D030011O10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320560
Homologene: 44911
Mlph
Name: melanophilin
Synonyms: Slac-2a, D1Wsu84e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171531
Homologene: 11465
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Ftsj3
Name: FtsJ RNA 2'-O-methyltransferase 3
Synonyms: D11Ertd400e, C79843, Epcs3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56095
Homologene: 5451
Pcdh7
Name: protocadherin 7
Synonyms: BH-protocadherin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54216
HGNC: HGNC:8659
Homologene: 36101
Sis
Name: sucrase isomaltase
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69983
Homologene: 37424
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Aox2
Name: aldehyde oxidase 2
Synonyms: Aox3l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213043
Homologene: 84622
Serpina12
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
Synonyms: vaspin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68054
Homologene: 23588
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Dpp6
Name: dipeptidylpeptidase 6
Synonyms: Dpp-6, Peplb, In(5)6H-p, Rw, LOC384168, B930011P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13483
HGNC: HGNC:3010
Homologene: 22560
Frmd4a
Name: FERM domain containing 4A
Synonyms: C230040M21Rik, 2700017I06Rik, Gm13190
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209630
Homologene: 9971
Dnai2
Name: dynein axonemal intermediate chain 2
Synonyms: C030015H18Rik, Dnaic2, b2b3405Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432611
Homologene: 11311
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Tmem184c
Name: transmembrane protein 184C
Synonyms: 8430433H16Rik, Tmem34
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234463
Homologene: 32403
Cep89
Name: centrosomal protein 89
Synonyms: 2610507L03Rik, Ccdc123
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72140
Homologene: 12444
Loxl1
Name: lysyl oxidase-like 1
Synonyms: LOXL
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16949
VEGA: 9
HGNC: HGNC:6665
Homologene: 4074
Myot
Name: myotilin
Synonyms: 5530402I04Rik, Ttid
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 58916
Homologene: 4942
Tmem120a
Name: transmembrane protein 120A
Synonyms: Tmpit, 2010310D06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215210
Homologene: 12907
Sting1
Name: stimulator of interferon response cGAMP interactor 1
Synonyms: 2610307O08Rik, MPYS, ERIS, Sting, Tmem173
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72512
VEGA: 18
Homologene: 18868
Tmx3
Name: thioredoxin-related transmembrane protein 3
Synonyms: 6430411B10Rik, A730024F05Rik, Txndc10
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67988
VEGA: 18
Homologene: 10381
Sned1
Name: sushi, nidogen and EGF-like domains 1
Synonyms: Snep, 6720455I24Rik, D430044C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208777
Homologene: 14708
Cobll1
Name: Cobl-like 1
Synonyms: Coblr1, D430044D16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319876
Homologene: 8933
Or5ak25
Name: olfactory receptor family 5 subfamily AK member 25
Synonyms: GA_x6K02T2Q125-46915844-46914897, MOR203-3, Olfr995
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258426
Homologene: 105170
Nmur2
Name: neuromedin U receptor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216749
Homologene: 49618
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Gfm1
Name: G elongation factor, mitochondrial 1
Synonyms: D3Wsu133e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 28030
Homologene: 6449
Smr3a
Name: submaxillary gland androgen regulated protein 3A
Synonyms: MSG3, MSG1, Smr3, Smr1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20599
Zbtb49
Name: zinc finger and BTB domain containing 49
Synonyms: 4930518A03Rik, Zfp509
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75079
Homologene: 34825
Panx2
Name: pannexin 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406218
HGNC: HGNC:8600
Homologene: 14155
Nfxl1
Name: nuclear transcription factor, X-box binding-like 1
Synonyms: TCF9, LOC381696, D430033A06Rik, 1700012H24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100978
Homologene: 26752
A530084C06Rik
Name: RIKEN cDNA A530084C06 gene
Type: Gene
Species: Mouse
Chromosome: 13
Caps2
Name: calcyphosphine 2
Synonyms: D630005B03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 353025
Homologene: 72278
Ptpn18
Name: protein tyrosine phosphatase, non-receptor type 18
Synonyms: HSCF, FLP1, Ptpk1, PTP-K1, PTP-HSCF
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19253
HGNC: HGNC:9649
Homologene: 74971
Tcirg1
Name: T cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
Synonyms: V-ATPase a3, OC-116, TIRC7, ATP6a3, Atp6i
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 27060
Homologene: 4392
Mtmr11
Name: myotubularin related protein 11
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 194126
Homologene: 82382
Dnah7c
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100101919
Homologene: 41287
Epha10
Name: Eph receptor A10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230735
Homologene: 67804
Gabra4
Name: gamma-aminobutyric acid type A receptor subunit alpha 4
Synonyms: Gabra-4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14397
HGNC: HGNC:4078
Homologene: 631
Tmem70
Name: transmembrane protein 70
Synonyms: 2210416J16Rik, 1110020A09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70397
Homologene: 9890
Rbm8a2
Name: RNA binding motif protein 8A2
Synonyms: Y14, B020018G12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545388
HGNC: HGNC:9905
1500011B03Rik
Name: RIKEN cDNA 1500011B03 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66236
Sult2a7
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 7
Synonyms: Gm7231
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 638251
Pcdhga2
Name: protocadherin gamma subfamily A, 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93710
HGNC: HGNC:8700
Homologene: 69262
Ccdc196
Name: coiled-coil domain containing 196
Synonyms: Gm6657
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 626215
Homologene: 79089
Gm21560
Name: predicted gene, 21560
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105245675
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 16,677,044 bp
  • A to T, chromosome 1 at 34,469,905 bp
  • A to T, chromosome 1 at 46,514,701 bp
  • A to G, chromosome 1 at 58,281,237 bp
  • A to T, chromosome 1 at 90,941,763 bp
  • G to C, chromosome 1 at 93,274,082 bp
  • T to A, chromosome 1 at 175,978,641 bp
  • T to A, chromosome 1 at 191,621,315 bp
  • T to C, chromosome 2 at 4,604,089 bp
  • A to G, chromosome 2 at 65,125,931 bp
  • T to C, chromosome 2 at 85,438,397 bp
  • A to T, chromosome 2 at 112,646,950 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • A to T, chromosome 2 at 180,671,597 bp
  • A to C, chromosome 3 at 53,461,659 bp
  • T to A, chromosome 3 at 67,473,527 bp
  • T to A, chromosome 3 at 72,937,251 bp
  • T to C, chromosome 3 at 88,621,262 bp
  • C to A, chromosome 3 at 96,170,428 bp
  • T to A, chromosome 3 at 122,282,369 bp
  • T to G, chromosome 3 at 122,508,253 bp
  • G to C, chromosome 4 at 40,260,356 bp
  • A to G, chromosome 4 at 94,621,977 bp
  • T to G, chromosome 4 at 108,603,371 bp
  • A to G, chromosome 4 at 124,914,835 bp
  • G to A, chromosome 4 at 137,548,116 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • C to T, chromosome 5 at 27,721,079 bp
  • G to T, chromosome 5 at 38,213,930 bp
  • A to G, chromosome 5 at 48,247,185 bp
  • A to G, chromosome 5 at 57,719,810 bp
  • C to A, chromosome 5 at 71,657,995 bp
  • G to A, chromosome 5 at 72,524,215 bp
  • C to T, chromosome 5 at 88,008,227 bp
  • T to C, chromosome 5 at 114,809,320 bp
  • C to A, chromosome 5 at 135,737,198 bp
  • A to C, chromosome 5 at 145,220,866 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to T, chromosome 6 at 149,041,661 bp
  • A to G, chromosome 7 at 14,465,209 bp
  • G to A, chromosome 7 at 35,429,928 bp
  • T to A, chromosome 7 at 46,427,821 bp
  • T to C, chromosome 7 at 79,669,485 bp
  • T to A, chromosome 7 at 116,521,970 bp
  • A to G, chromosome 8 at 77,597,811 bp
  • G to A, chromosome 8 at 84,594,173 bp
  • A to T, chromosome 8 at 110,587,748 bp
  • T to G, chromosome 9 at 8,903,742 bp
  • T to C, chromosome 9 at 18,640,697 bp
  • C to T, chromosome 9 at 58,290,834 bp
  • T to C, chromosome 9 at 63,616,850 bp
  • A to T, chromosome 10 at 5,227,956 bp
  • A to G, chromosome 10 at 82,282,897 bp
  • A to G, chromosome 10 at 86,064,929 bp
  • C to A, chromosome 10 at 112,165,761 bp
  • C to A, chromosome 11 at 56,040,335 bp
  • T to C, chromosome 11 at 69,590,693 bp
  • C to A, chromosome 11 at 106,252,289 bp
  • T to C, chromosome 11 at 114,738,630 bp
  • A to C, chromosome 12 at 28,595,282 bp
  • A to G, chromosome 12 at 78,197,422 bp
  • C to A, chromosome 12 at 100,878,448 bp
  • A to G, chromosome 12 at 104,038,265 bp
  • G to T, chromosome 13 at 31,558,995 bp
  • A to T, chromosome 14 at 6,218,220 bp
  • A to T, chromosome 15 at 8,119,179 bp
  • A to G, chromosome 15 at 34,123,719 bp
  • A to G, chromosome 15 at 89,068,733 bp
  • G to T, chromosome 17 at 24,702,484 bp
  • TCAGGGTGGGGGTAGAGCCTGAGCCACTGCTAGATGCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAG to TCAGGGTGGGGGTAGAGCCTGAG, chromosome 17 at 35,620,601 bp
  • T to C, chromosome 18 at 10,000,563 bp
  • A to G, chromosome 18 at 35,734,573 bp
  • G to C, chromosome 18 at 37,670,857 bp
  • A to G, chromosome 18 at 44,354,184 bp
  • A to T, chromosome 18 at 90,527,874 bp
  • A to T, chromosome 19 at 3,899,104 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7899 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045951-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.