Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7958Btlr/Mmmh
Stock Number:
046002-MU
Citation ID:
RRID:MMRRC_046002-MU
Other Names:
R7958 (G1)
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, NP-2, 1110048P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Ranbp17
Name: RAN binding protein 17
Synonyms: 4932704E15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66011
Homologene: 36409
Fgfr1
Name: fibroblast growth factor receptor 1
Synonyms: Flt-2, Fgfr-1, Hspy, Eask, FGFR-I, Fr1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14182
HGNC: HGNC:3688
Homologene: 69065
Cwc27
Name: CWC27 spliceosome-associated protein
Synonyms: NY-CO-10, 3110009E13Rik, Sdccag10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67285
Homologene: 21192
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: nonmuscle myosin heavy chain II-B, NMHC-B, SMemb, nonmuscle myosin heavy chain IIB, 9330167F11Rik, 5730504C04Rik, NMHC II-B, Myhn2, Myosin IIB, Myhn-2, myosin IIB, Fltn, Fltn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: 5033413A03Rik, SRm300
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Phkb
Name: phosphorylase kinase beta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102093
HGNC: HGNC:8927
Homologene: 247
Scaf8
Name: SR-related CTD-associated factor 8
Synonyms: A930036P18Rik, A630086M08Rik, Rbm16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106583
VEGA: 17
Homologene: 8928
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Dhrs4
Name: dehydrogenase/reductase 4
Synonyms: RRD, D14Ucla2, dehydrogenase/reductase (SDR family) member 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 28200
VEGA: 14
Homologene: 49646
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Ube3b
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117146
Homologene: 13775
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: C530005A01Rik, 6030465E24Rik, spastic paraplegia 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214585
Homologene: 41614
Klhl12
Name: kelch-like 12
Synonyms: C3ip1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240756
Homologene: 23317
Lifr
Name: LIF receptor alpha
Synonyms: soluble differentiation-stimulating factor receptor, A230075M04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16880
VEGA: 15
HGNC: HGNC:6597
Homologene: 1735
Nipbl
Name: NIPBL cohesin loading factor
Synonyms: 4921518A06Rik, 4933421G18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71175
VEGA: 15
Homologene: 15850
Alg8
Name: ALG8 alpha-1,3-glucosyltransferase
Synonyms: LOC381903
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381903
Homologene: 6931
Klrg1
Name: killer cell lectin-like receptor subfamily G, member 1
Synonyms: 2F1-Ag
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50928
HGNC: HGNC:6380
Homologene: 4244
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Plekhg4
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms: 4931414L13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102075
Homologene: 18516
Cdh5
Name: cadherin 5
Synonyms: VE-cadherin, 7B4/cadherin-5, VEC, CD144, VE-Cad, VECD, VEcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12562
HGNC: HGNC:1764
Homologene: 1359
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Serpinb1b
Name: serine (or cysteine) peptidase inhibitor, clade B, member 1b
Synonyms: 6330533H24Rik, ovalbumin, EIB
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 282663
HGNC: HGNC:3311
Homologene: 138408
Vmn2r104
Name: vomeronasal 2, receptor 104
Synonyms: V2r7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22313
Homologene: 129751
Or8a1
Name: olfactory receptor family 8 subfamily A member 1
Synonyms: M71, MOR171-2, GA_x6K02T2PVTD-31408136-31407207, Olfr151
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 406176
HGNC: HGNC:8469
Homologene: 12726
Oas2
Name: 2'-5' oligoadenylate synthetase 2
Synonyms: 2'-5' oligoadenylate synthetase-like 11, Oasl11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246728
HGNC: HGNC:8087
Homologene: 49478
Fpr-rs6
Name: formyl peptide receptor, related sequence 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 321020
Homologene: 104303
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Fam171a1
Name: family with sequence similarity 171, member A1
Synonyms: 9630050M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269233
Homologene: 19521
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: LOC380973, 1700030F18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Aldh1l2
Name: aldehyde dehydrogenase 1 family, member L2
Synonyms: D330038I09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216188
Homologene: 51942
Hhatl
Name: hedgehog acyltransferase-like
Synonyms: 1110011D13Rik, Gup1, Mitsugumin 56, Mg56
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74770
VEGA: 9
Homologene: 19287
Lrrc25
Name: leucine rich repeat containing 25
Synonyms: Mapa
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211228
Homologene: 51663
Tbpl2
Name: TATA box binding protein like 2
Synonyms: LOC227606, Trf3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227606
Homologene: 133152
Sh2d1b1
Name: SH2 domain containing 1B1
Synonyms: EAT-2, Eat2, Eat2a, Sh2d1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26904
Homologene: 8070
4930590J08Rik
Name: RIKEN cDNA 4930590J08 gene
Synonyms: LOC381798
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381798
Homologene: 49985
Tjp3
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27375
VEGA: 10
Homologene: 8458
Potefam1
Name: POTE ankyrin domain family member 1
Synonyms: Pote1, 4930430A15Rik, A26c3, Potea
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67575
Homologene: 69410
Cyp2a12
Name: cytochrome P450, family 2, subfamily a, polypeptide 12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13085
Homologene: 69128
Sgsh
Name: N-sulfoglucosamine sulfohydrolase (sulfamidase)
Synonyms: sulphamidase, 4632406A19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27029
Homologene: 167
Vmn1r65
Name: vomeronasal 1 receptor 65
Synonyms: V3R6, V1rd6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81013
Homologene: 110799
Vmn1r42
Name: vomeronasal 1 receptor 42
Synonyms: V1ra6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113848
Homologene: 130651
Oosp3
Name: oocyte secreted protein 3
Synonyms: LOC225923, Gm97
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225923
Tbc1d30
Name: TBC1 domain family, member 30
Synonyms: 4930505D03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74694
VEGA: 10
Homologene: 18930
Krtap19-4
Name: keratin associated protein 19-4
Synonyms: Krtap16-4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 170654
VEGA: 16
Spo11
Name: SPO11 initiator of meiotic double stranded breaks
Synonyms: Spo11b, Spo11a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26972
Homologene: 6059
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Wdr49
Name: WD repeat domain 49
Synonyms: EG213248
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213248
Homologene: 18714
Gm28360
Name: predicted gene 28360
Type: Gene
Species: Mouse
Chromosome: 1
Vmn1r151
Name: vomeronasal 1 receptor 151
Synonyms: Gm5727
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435947
Homologene: 104166
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 62,745,408 bp
  • T to C, chromosome 1 at 80,271,557 bp
  • T to A, chromosome 1 at 117,853,679 bp
  • G to A, chromosome 1 at 134,467,717 bp
  • A to G, chromosome 1 at 170,283,135 bp
  • G to A, chromosome 1 at 174,174,390 bp
  • T to A, chromosome 2 at 3,178,261 bp
  • A to T, chromosome 2 at 24,095,067 bp
  • T to A, chromosome 2 at 65,506,193 bp
  • T to C, chromosome 2 at 90,469,627 bp
  • T to C, chromosome 2 at 111,170,325 bp
  • T to A, chromosome 2 at 122,092,945 bp
  • T to A, chromosome 2 at 172,984,022 bp
  • T to A, chromosome 3 at 75,431,147 bp
  • T to C, chromosome 3 at 95,888,912 bp
  • A to T, chromosome 4 at 113,623,783 bp
  • T to C, chromosome 5 at 114,401,423 bp
  • C to T, chromosome 5 at 120,748,766 bp
  • A to T, chromosome 6 at 89,845,077 bp
  • A to T, chromosome 6 at 91,934,483 bp
  • T to A, chromosome 6 at 122,271,372 bp
  • A to G, chromosome 7 at 6,008,255 bp
  • A to T, chromosome 7 at 22,499,067 bp
  • T to A, chromosome 7 at 27,029,252 bp
  • T to C, chromosome 7 at 97,386,921 bp
  • G to T, chromosome 8 at 25,532,342 bp
  • A to G, chromosome 8 at 70,617,847 bp
  • T to A, chromosome 8 at 81,969,589 bp
  • G to T, chromosome 8 at 86,021,663 bp
  • A to T, chromosome 8 at 104,113,017 bp
  • A to T, chromosome 8 at 105,376,649 bp
  • A to G, chromosome 9 at 37,730,386 bp
  • A to G, chromosome 9 at 66,486,193 bp
  • A to G, chromosome 9 at 121,784,586 bp
  • T to A, chromosome 10 at 20,229,829 bp
  • C to T, chromosome 10 at 81,282,994 bp
  • C to T, chromosome 10 at 83,520,338 bp
  • C to A, chromosome 10 at 121,272,057 bp
  • A to G, chromosome 11 at 33,487,702 bp
  • A to G, chromosome 11 at 68,721,347 bp
  • T to C, chromosome 11 at 77,841,557 bp
  • A to G, chromosome 11 at 110,031,672 bp
  • T to C, chromosome 11 at 119,352,773 bp
  • A to T, chromosome 13 at 33,089,653 bp
  • T to C, chromosome 13 at 104,804,964 bp
  • T to C, chromosome 14 at 55,487,621 bp
  • A to T, chromosome 14 at 103,129,964 bp
  • T to C, chromosome 15 at 7,181,997 bp
  • A to G, chromosome 15 at 8,311,258 bp
  • A to T, chromosome 15 at 99,943,308 bp
  • A to G, chromosome 16 at 88,884,945 bp
  • G to A, chromosome 17 at 3,171,122 bp
  • T to C, chromosome 17 at 20,042,726 bp
  • T to A, chromosome 17 at 20,182,443 bp
  • T to C, chromosome 17 at 23,821,312 bp
  • A to T, chromosome 19 at 11,705,456 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7958 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046002-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.