Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7958Btlr/Mmmh
Stock Number:
046002-MU
Citation ID:
RRID:MMRRC_046002-MU
Other Names:
R7958 (G1)
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, NP-2, 1110048P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Ranbp17
Name: RAN binding protein 17
Synonyms: 4932704E15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66011
Homologene: 36409
Fgfr1
Name: fibroblast growth factor receptor 1
Synonyms: Flt-2, Fgfr-1, Hspy, Eask, FGFR-I, Fr1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14182
HGNC: HGNC:3688
Homologene: 69065
Cwc27
Name: CWC27 spliceosome-associated protein
Synonyms: NY-CO-10, 3110009E13Rik, Sdccag10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67285
Homologene: 21192
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 62,745,408 bp
  • T to C, chromosome 1 at 80,271,557 bp
  • T to A, chromosome 1 at 117,853,679 bp
  • G to A, chromosome 1 at 134,467,717 bp
  • A to G, chromosome 1 at 170,283,135 bp
  • G to A, chromosome 1 at 174,174,390 bp
  • T to A, chromosome 2 at 3,178,261 bp
  • A to T, chromosome 2 at 24,095,067 bp
  • T to A, chromosome 2 at 65,506,193 bp
  • T to C, chromosome 2 at 90,469,627 bp
  • T to C, chromosome 2 at 111,170,325 bp
  • T to A, chromosome 2 at 122,092,945 bp
  • T to A, chromosome 2 at 172,984,022 bp
  • T to A, chromosome 3 at 75,431,147 bp
  • T to C, chromosome 3 at 95,888,912 bp
  • A to T, chromosome 4 at 113,623,783 bp
  • T to C, chromosome 5 at 114,401,423 bp
  • C to T, chromosome 5 at 120,748,766 bp
  • A to T, chromosome 6 at 89,845,077 bp
  • A to T, chromosome 6 at 91,934,483 bp
  • T to A, chromosome 6 at 122,271,372 bp
  • A to G, chromosome 7 at 6,008,255 bp
  • A to T, chromosome 7 at 22,499,067 bp
  • T to A, chromosome 7 at 27,029,252 bp
  • T to C, chromosome 7 at 97,386,921 bp
  • G to T, chromosome 8 at 25,532,342 bp
  • A to G, chromosome 8 at 70,617,847 bp
  • T to A, chromosome 8 at 81,969,589 bp
  • G to T, chromosome 8 at 86,021,663 bp
  • A to T, chromosome 8 at 104,113,017 bp
  • A to T, chromosome 8 at 105,376,649 bp
  • A to G, chromosome 9 at 37,730,386 bp
  • A to G, chromosome 9 at 66,486,193 bp
  • A to G, chromosome 9 at 121,784,586 bp
  • T to A, chromosome 10 at 20,229,829 bp
  • C to T, chromosome 10 at 81,282,994 bp
  • C to T, chromosome 10 at 83,520,338 bp
  • C to A, chromosome 10 at 121,272,057 bp
  • A to G, chromosome 11 at 33,487,702 bp
  • A to G, chromosome 11 at 68,721,347 bp
  • T to C, chromosome 11 at 77,841,557 bp
  • A to G, chromosome 11 at 110,031,672 bp
  • T to C, chromosome 11 at 119,352,773 bp
  • A to T, chromosome 13 at 33,089,653 bp
  • T to C, chromosome 13 at 104,804,964 bp
  • T to C, chromosome 14 at 55,487,621 bp
  • A to T, chromosome 14 at 103,129,964 bp
  • T to C, chromosome 15 at 7,181,997 bp
  • A to G, chromosome 15 at 8,311,258 bp
  • A to T, chromosome 15 at 99,943,308 bp
  • A to G, chromosome 16 at 88,884,945 bp
  • G to A, chromosome 17 at 3,171,122 bp
  • T to C, chromosome 17 at 20,042,726 bp
  • T to A, chromosome 17 at 20,182,443 bp
  • T to C, chromosome 17 at 23,821,312 bp
  • A to T, chromosome 19 at 11,705,456 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7958 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046002-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.