Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7983Btlr/Mmmh
Stock Number:
046024-MU
Citation ID:
RRID:MMRRC_046024-MU
Other Names:
R7983 (G1)
Major Collection:

Strain Information

Foxq1
Name: forkhead box Q1
Synonyms: HFH-1, Hfh1l, Hfh1, sa
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15220
Homologene: 7359
Sp4
Name: trans-acting transcription factor 4
Synonyms: HF1-b, HF-1b, 5730497N03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20688
VEGA: 12
Homologene: 2341
Cds2
Name: CDP-diacylglycerol synthase 2
Synonyms: 5730460C18Rik, D2Wsu127e, 5730450N06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110911
HGNC: HGNC:1801
Homologene: 37854
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Eif4g3
Name: eukaryotic translation initiation factor 4 gamma, 3
Synonyms: eIF4GII, 1500002J22Rik, 4930523M17Rik, G1-419-52, repro8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230861
HGNC: HGNC:3298
Homologene: 2789
Dhrs7b
Name: dehydrogenase/reductase 7B
Synonyms: dehydrogenase/reductase (SDR family) member 7B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216820
Homologene: 41044
Prr11
Name: proline rich 11
Synonyms: B930067F20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 270906
Homologene: 10123
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 15,312,780 bp
  • T to A, chromosome 1 at 46,243,424 bp
  • T to C, chromosome 1 at 105,284,364 bp
  • A to G, chromosome 2 at 83,923,567 bp
  • T to G, chromosome 2 at 132,263,510 bp
  • T to C, chromosome 3 at 63,707,743 bp
  • T to A, chromosome 4 at 8,752,628 bp
  • T to A, chromosome 4 at 8,844,609 bp
  • A to T, chromosome 4 at 115,250,902 bp
  • A to T, chromosome 4 at 138,151,593 bp
  • T to C, chromosome 5 at 87,694,497 bp
  • T to C, chromosome 5 at 113,062,080 bp
  • G to T, chromosome 6 at 4,624,472 bp
  • A to C, chromosome 6 at 65,538,646 bp
  • G to A, chromosome 6 at 90,415,705 bp
  • C to A, chromosome 6 at 96,165,907 bp
  • A to G, chromosome 7 at 7,902,416 bp
  • G to A, chromosome 7 at 13,915,227 bp
  • A to T, chromosome 7 at 26,840,441 bp
  • T to A, chromosome 7 at 44,585,327 bp
  • T to C, chromosome 7 at 106,865,751 bp
  • G to T, chromosome 8 at 78,434,939 bp
  • T to C, chromosome 8 at 128,881,078 bp
  • T to C, chromosome 9 at 121,712,609 bp
  • A to G, chromosome 10 at 62,955,394 bp
  • A to T, chromosome 10 at 79,912,723 bp
  • G to T, chromosome 10 at 107,608,411 bp
  • T to C, chromosome 11 at 60,852,461 bp
  • C to T, chromosome 11 at 87,091,811 bp
  • C to T, chromosome 12 at 80,601,824 bp
  • A to C, chromosome 12 at 102,369,159 bp
  • A to T, chromosome 12 at 118,301,232 bp
  • T to C, chromosome 13 at 31,559,989 bp
  • A to G, chromosome 14 at 30,797,716 bp
  • A to G, chromosome 14 at 54,220,757 bp
  • T to C, chromosome 14 at 123,592,997 bp
  • T to A, chromosome 15 at 8,221,815 bp
  • A to G, chromosome 15 at 39,077,155 bp
  • T to C, chromosome 16 at 48,872,898 bp
  • G to A, chromosome 16 at 58,761,014 bp
  • T to C, chromosome 17 at 15,820,927 bp
  • T to C, chromosome 17 at 35,116,328 bp
  • G to A, chromosome 18 at 31,583,430 bp
  • G to T, chromosome 18 at 68,235,669 bp
  • G to A, chromosome 19 at 58,680,059 bp
  • AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC to AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC, chromosome X at 61,184,524 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7983 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046024-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.