Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7983Btlr/Mmmh
Stock Number:
046024-MU
Citation ID:
RRID:MMRRC_046024-MU
Other Names:
R7983 (G1)
Major Collection:

Strain Information

Foxq1
Name: forkhead box Q1
Synonyms: HFH-1, Hfh1l, Hfh1, sa
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15220
Homologene: 7359
Sp4
Name: trans-acting transcription factor 4
Synonyms: HF1-b, HF-1b, 5730497N03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20688
VEGA: 12
Homologene: 2341
Cds2
Name: CDP-diacylglycerol synthase 2
Synonyms: 5730460C18Rik, D2Wsu127e, 5730450N06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110911
HGNC: HGNC:1801
Homologene: 37854
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Eif4g3
Name: eukaryotic translation initiation factor 4 gamma, 3
Synonyms: eIF4GII, 1500002J22Rik, 4930523M17Rik, G1-419-52, repro8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230861
HGNC: HGNC:3298
Homologene: 2789
Dhrs7b
Name: dehydrogenase/reductase 7B
Synonyms: dehydrogenase/reductase (SDR family) member 7B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216820
Homologene: 41044
Prr11
Name: proline rich 11
Synonyms: B930067F20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 270906
Homologene: 10123
Slc25a46
Name: solute carrier family 25, member 46
Synonyms: 1200007B05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67453
VEGA: 18
Homologene: 14518
Csn2
Name: casein beta
Synonyms: CSN2, Csnb
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12991
HGNC: HGNC:2447
Homologene: 1426
Cthrc1
Name: collagen triple helix repeat containing 1
Synonyms: 1110014B07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68588
Homologene: 16320
Csnk2b
Name: casein kinase 2, beta polypeptide
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13001
HGNC: HGNC:2460
Homologene: 55572
Dna2
Name: DNA replication helicase/nuclease 2
Synonyms: E130315B21Rik, Dna2l
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327762
HGNC: HGNC:2939
Homologene: 6124
Pou4f2
Name: POU domain, class 4, transcription factor 2
Synonyms: Brn-3.2, Brn-3b, mBrn3-3R, Brn3b, Pou4f-rs1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18997
HGNC: HGNC:9219
Homologene: 20959
Ldlrad4
Name: low density lipoprotein receptor class A domain containing 4
Synonyms: D330030L18Rik, A430108L08Rik, 8230401C20Rik, D18Ertd653e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 52662
VEGA: 18
HGNC: HGNC:1224
Homologene: 3202
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Galnt16
Name: polypeptide N-acetylgalactosaminyltransferase 16
Synonyms: 5730405L21Rik, Galntl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108760
VEGA: 12
Homologene: 18907
Sfmbt1
Name: Scm-like with four mbt domains 1
Synonyms: Smr, 4930442N21Rik, 9330180L21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54650
Homologene: 9472
Ss18l2
Name: SS18, nBAF chromatin remodeling complex subunit like 2
Synonyms: Band 47B, 1110020I04Rik, Deb1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26901
VEGA: 9
Homologene: 32307
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Kcnb2
Name: potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms: Kv2.2, 9630047L19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98741
HGNC: HGNC:6232
Homologene: 31263
Nup50l
Name: nucleoporin 50 like
Synonyms: 1700123L14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78482
HGNC: HGNC:8065
Cyp4a29
Name: cytochrome P450, family 4, subfamily a, polypeptide 29
Synonyms: Cyp4a29-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230639
Cdr1
Name: cerebellar degeneration related antigen 1
Synonyms: Cdr34, Gm7077, Gm2409
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 631990
VEGA: X
HGNC: HGNC:1798
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269437
Homologene: 88833
Cfap100
Name: cilia and flagella associated protein 100
Synonyms: C030041G11Rik, C230069K22Rik, Ccdc37
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243538
Homologene: 18456
Napsa
Name: napsin A aspartic peptidase
Synonyms: napsin, pronapsin, NAP1, Kdap
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16541
Homologene: 68418
Ccdc7a
Name: coiled-coil domain containing 7A
Synonyms: 4930540C21Rik, 4930517G15Rik, Ccdc7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74703
Homologene: 134760
Zswim2
Name: zinc finger SWIM-type containing 2
Synonyms: 1700025P14Rik, 4933437F18Rik, MEX
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71861
Homologene: 32689
Casd1
Name: CAS1 domain containing 1
Synonyms: Cast1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213819
Homologene: 11287
Tnip3
Name: TNFAIP3 interacting protein 3
Synonyms: 9030611K07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 414084
Homologene: 47979
Cyp2a5
Name: cytochrome P450, family 2, subfamily a, polypeptide 5
Synonyms: Coh
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13087
Homologene: 85917
Crybb2
Name: crystallin, beta B2
Synonyms: betaB2-crystallin, Cryb-2, Aey2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12961
HGNC: HGNC:2398
Homologene: 420
R3hdm4
Name: R3H domain containing 4
Synonyms: C030046I01Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 109284
VEGA: 10
Homologene: 16343
Sult2a4
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4
Synonyms: Gm5584
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434121
Homologene: 37741
Pnlip
Name: pancreatic lipase
Synonyms: pancreatic triglyceride lipase, PTL, 1810007A24Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69060
VEGA: 19
HGNC: HGNC:9155
Homologene: 30999
Retnlg
Name: resistin like gamma
Synonyms: Fizz3, Relmg, Xcp1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 245195
VEGA: 16
Homologene: 138458
Or5k1b
Name: olfactory receptor family 5 subfamily K member 1B
Synonyms: GA_x54KRFPKG5P-54930346-54929417, MOR184-2, Olfr172
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259003
Homologene: 45084
Rgmb
Name: repulsive guidance molecule family member B
Synonyms: 1110059F19Rik, DRAGON, RGM domain family, member B
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68799
VEGA: 17
Homologene: 65355
Rnf152
Name: ring finger protein 152
Synonyms: A930029B02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320311
Homologene: 18317
Or2ag20
Name: olfactory receptor family 2 subfamily AG member 20
Synonyms: GA_x6K02T2PBJ9-9247095-9248042, MOR283-12P, Olfr704
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257902
Homologene: 79345
Vmn2r36
Name: vomeronasal 2, receptor 36
Synonyms: Gm3991
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042653
Homologene: 113703
Trac
Name: T cell receptor alpha constant
Synonyms: Tcra-C, Gm16914
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100101484
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 15,312,780 bp
  • T to A, chromosome 1 at 46,243,424 bp
  • T to C, chromosome 1 at 105,284,364 bp
  • A to G, chromosome 2 at 83,923,567 bp
  • T to G, chromosome 2 at 132,263,510 bp
  • T to C, chromosome 3 at 63,707,743 bp
  • T to A, chromosome 4 at 8,752,628 bp
  • T to A, chromosome 4 at 8,844,609 bp
  • A to T, chromosome 4 at 115,250,902 bp
  • A to T, chromosome 4 at 138,151,593 bp
  • T to C, chromosome 5 at 87,694,497 bp
  • T to C, chromosome 5 at 113,062,080 bp
  • G to T, chromosome 6 at 4,624,472 bp
  • A to C, chromosome 6 at 65,538,646 bp
  • G to A, chromosome 6 at 90,415,705 bp
  • C to A, chromosome 6 at 96,165,907 bp
  • A to G, chromosome 7 at 7,902,416 bp
  • G to A, chromosome 7 at 13,915,227 bp
  • A to T, chromosome 7 at 26,840,441 bp
  • T to A, chromosome 7 at 44,585,327 bp
  • T to C, chromosome 7 at 106,865,751 bp
  • G to T, chromosome 8 at 78,434,939 bp
  • T to C, chromosome 8 at 128,881,078 bp
  • T to C, chromosome 9 at 121,712,609 bp
  • A to G, chromosome 10 at 62,955,394 bp
  • A to T, chromosome 10 at 79,912,723 bp
  • G to T, chromosome 10 at 107,608,411 bp
  • T to C, chromosome 11 at 60,852,461 bp
  • C to T, chromosome 11 at 87,091,811 bp
  • C to T, chromosome 12 at 80,601,824 bp
  • A to C, chromosome 12 at 102,369,159 bp
  • A to T, chromosome 12 at 118,301,232 bp
  • T to C, chromosome 13 at 31,559,989 bp
  • A to G, chromosome 14 at 30,797,716 bp
  • A to G, chromosome 14 at 54,220,757 bp
  • T to C, chromosome 14 at 123,592,997 bp
  • T to A, chromosome 15 at 8,221,815 bp
  • A to G, chromosome 15 at 39,077,155 bp
  • T to C, chromosome 16 at 48,872,898 bp
  • G to A, chromosome 16 at 58,761,014 bp
  • T to C, chromosome 17 at 15,820,927 bp
  • T to C, chromosome 17 at 35,116,328 bp
  • G to A, chromosome 18 at 31,583,430 bp
  • G to T, chromosome 18 at 68,235,669 bp
  • G to A, chromosome 19 at 58,680,059 bp
  • AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC to AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC, chromosome X at 61,184,524 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7983 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046024-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.