Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8062Btlr/Mmmh
Stock Number:
067498-MU
Citation ID:
RRID:MMRRC_067498-MU
Other Names:
R8062 (G1)
Major Collection:

Strain Information

Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Abce1
Name: ATP-binding cassette, sub-family E member 1
Synonyms: RNS4l (Eye), Oabp, Rnaseli
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24015
HGNC: HGNC:69
Homologene: 2205
Eif2s2
Name: eukaryotic translation initiation factor 2 subunit 2 beta
Synonyms: EIF2B, EIF2, 2810026E11Rik, 38kDa, D2Ertd303e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67204
HGNC: HGNC:3266
Homologene: 2904
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, Glur4, spkw1, Gluralpha4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 86,024,426 bp
  • A to G, chromosome 1 at 93,438,342 bp
  • A to T, chromosome 1 at 163,038,975 bp
  • A to G, chromosome 2 at 34,678,114 bp
  • T to A, chromosome 2 at 71,841,743 bp
  • T to A, chromosome 2 at 74,551,063 bp
  • A to C, chromosome 2 at 86,677,066 bp
  • T to A, chromosome 2 at 90,015,736 bp
  • C to T, chromosome 2 at 110,000,937 bp
  • A to G, chromosome 2 at 121,140,272 bp
  • A to G, chromosome 2 at 154,877,804 bp
  • A to G, chromosome 2 at 181,340,567 bp
  • A to T, chromosome 3 at 59,210,282 bp
  • A to T, chromosome 3 at 72,920,988 bp
  • T to A, chromosome 3 at 100,142,494 bp
  • T to G, chromosome 3 at 108,266,479 bp
  • G to A, chromosome 4 at 32,562,937 bp
  • T to A, chromosome 4 at 33,944,707 bp
  • G to A, chromosome 4 at 63,861,195 bp
  • T to G, chromosome 4 at 66,839,850 bp
  • T to A, chromosome 4 at 96,215,350 bp
  • T to G, chromosome 4 at 146,654,958 bp
  • T to G, chromosome 5 at 3,605,656 bp
  • A to T, chromosome 5 at 15,620,439 bp
  • T to A, chromosome 5 at 21,194,463 bp
  • G to A, chromosome 5 at 21,971,992 bp
  • A to T, chromosome 5 at 136,990,269 bp
  • T to A, chromosome 5 at 147,527,150 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • C to A, chromosome 6 at 24,876,197 bp
  • A to T, chromosome 6 at 39,364,596 bp
  • C to A, chromosome 6 at 132,600,688 bp
  • C to A, chromosome 7 at 10,040,313 bp
  • A to G, chromosome 7 at 64,201,941 bp
  • T to A, chromosome 7 at 79,325,590 bp
  • T to G, chromosome 7 at 97,677,387 bp
  • T to A, chromosome 7 at 104,366,186 bp
  • A to C, chromosome 7 at 120,201,168 bp
  • A to G, chromosome 7 at 139,918,844 bp
  • T to G, chromosome 8 at 71,321,813 bp
  • A to T, chromosome 8 at 79,701,144 bp
  • T to C, chromosome 8 at 80,984,589 bp
  • T to A, chromosome 8 at 84,903,299 bp
  • A to T, chromosome 8 at 111,020,979 bp
  • C to T, chromosome 9 at 4,480,273 bp
  • G to A, chromosome 9 at 26,881,821 bp
  • G to T, chromosome 9 at 38,108,917 bp
  • C to A, chromosome 9 at 45,328,688 bp
  • A to T, chromosome 9 at 70,573,497 bp
  • A to G, chromosome 10 at 5,185,394 bp
  • T to A, chromosome 10 at 49,240,767 bp
  • G to A, chromosome 10 at 58,223,810 bp
  • A to C, chromosome 10 at 58,230,928 bp
  • G to A, chromosome 10 at 58,231,067 bp
  • A to G, chromosome 10 at 61,200,361 bp
  • C to A, chromosome 10 at 77,782,400 bp
  • T to A, chromosome 10 at 89,654,160 bp
  • G to T, chromosome 11 at 67,193,383 bp
  • A to G, chromosome 11 at 86,319,438 bp
  • G to A, chromosome 11 at 114,806,531 bp
  • A to G, chromosome 12 at 57,736,978 bp
  • A to G, chromosome 12 at 101,041,971 bp
  • T to A, chromosome 12 at 102,484,480 bp
  • A to G, chromosome 13 at 3,854,405 bp
  • T to A, chromosome 13 at 22,293,270 bp
  • T to C, chromosome 13 at 62,370,341 bp
  • T to A, chromosome 14 at 31,257,508 bp
  • T to A, chromosome 14 at 47,724,972 bp
  • A to T, chromosome 14 at 75,592,606 bp
  • G to A, chromosome 15 at 6,427,341 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • A to T, chromosome 15 at 11,388,314 bp
  • G to A, chromosome 15 at 76,046,754 bp
  • T to A, chromosome 16 at 32,756,749 bp
  • A to T, chromosome 17 at 38,209,174 bp
  • A to T, chromosome 17 at 53,515,770 bp
  • C to T, chromosome 18 at 20,032,274 bp
  • T to A, chromosome 18 at 63,030,466 bp
  • T to C, chromosome 19 at 6,252,579 bp
  • G to A, chromosome 19 at 36,992,465 bp
  • T to A, chromosome 19 at 44,056,159 bp
  • A to G, chromosome 19 at 47,130,713 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8062 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067498-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.