Strain Name:
C57BL/6J-MtgxR8062Btlr/Mmmh
Stock Number:
067498-MU
Citation ID:
RRID:MMRRC_067498-MU
Other Names:
R8062 (G1)
Major Collection:

Strain Information

Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Abce1
Name: ATP-binding cassette, sub-family E member 1
Synonyms: RNS4l (Eye), Oabp, Rnaseli
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24015
HGNC: HGNC:69
Homologene: 2205
Eif2s2
Name: eukaryotic translation initiation factor 2 subunit 2 beta
Synonyms: EIF2B, EIF2, 2810026E11Rik, 38kDa, D2Ertd303e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67204
HGNC: HGNC:3266
Homologene: 2904
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Rtel1
Name: regulator of telomere elongation helicase 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269400
Homologene: 13168
Crym
Name: crystallin, mu
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12971
HGNC: HGNC:2418
Homologene: 1424
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, Glur4, spkw1, Gluralpha4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Slc37a3
Name: solute carrier family 37 (glycerol-3-phosphate transporter), member 3
Synonyms: 2610507O21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72144
Homologene: 41740
Usp38
Name: ubiquitin specific peptidase 38
Synonyms: 4631402N15Rik, 4833420O05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74841
Homologene: 12367
Hdlbp
Name: high density lipoprotein (HDL) binding protein
Synonyms: D1Ertd101e, 1110005P14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110611
HGNC: HGNC:4857
Homologene: 38035
Btaf1
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107182
Homologene: 31978
Psma5
Name: proteasome subunit alpha 5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26442
HGNC: HGNC:9534
Homologene: 2084
Golga5
Name: golgin A5
Synonyms: Ret-II
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27277
VEGA: 12
HGNC: HGNC:4428
Homologene: 38009
Lgr4
Name: leucine-rich repeat-containing G protein-coupled receptor 4
Synonyms: A930009A08Rik, Gpr48, A330106J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107515
Homologene: 10226
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Wdr3
Name: WD repeat domain 3
Synonyms: D030020G18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269470
Homologene: 4937
Gapvd1
Name: GTPase activating protein and VPS9 domains 1
Synonyms: 2010005B09Rik, 4432404J10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66691
Homologene: 32637
Myo9b
Name: myosin IXb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17925
HGNC: HGNC:7609
Homologene: 3058
Pdcd11
Name: programmed cell death 11
Synonyms: ALG-4, 1110021I22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18572
VEGA: 19
Homologene: 74968
Sltm
Name: SAFB-like, transcription modulator
Synonyms: 5730455C01Rik, 9130215G10Rik, 5730555F13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66660
VEGA: 9
Homologene: 11696
Pex1
Name: peroxisomal biogenesis factor 1
Synonyms: ZWS1, 5430414H02Rik, E330005K07Rik, peroxisome biogenesis factor 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71382
HGNC: HGNC:8850
Homologene: 27006
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Pan3
Name: PAN3 poly(A) specific ribonuclease subunit
Synonyms: 2700050F09Rik, A430027N15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72587
Homologene: 6372
Cnr1
Name: cannabinoid receptor 1
Synonyms: CB1, CB1R
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12801
HGNC: HGNC:2159
Homologene: 7273
Tlr4
Name: toll-like receptor 4
Synonyms: Lps, Rasl2-8, lipopolysaccharide response
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21898
Homologene: 41317
Scyl2
Name: SCY1-like 2 (S. cerevisiae)
Synonyms: D10Ertd802e, CVAK104
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213326
Homologene: 13349
Ppp4r3a
Name: protein phosphatase 4 regulatory subunit 3A
Synonyms: 1110034C04Rik, Smek1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68734
VEGA: 12
Homologene: 69510
Med13
Name: mediator complex subunit 13
Synonyms: Trap240, 1110067M05Rik, Thrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327987
Homologene: 21067
Bach2
Name: BTB and CNC homology, basic leucine zipper transcription factor 2
Synonyms: E030004N02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12014
Homologene: 7240
Tars1
Name: threonyl-tRNA synthetase 1
Synonyms: ThrRS, D15Wsu59e, Tars
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110960
VEGA: 15
Homologene: 11852
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Zfp993
Name: zinc finger protein 993
Synonyms: Gm13248
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100503000
Reln
Name: reelin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Tnfsf8
Name: tumor necrosis factor (ligand) superfamily, member 8
Synonyms: Cd30L, CD153, CD30LG
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21949
Homologene: 950
Or8b101
Name: olfactory receptor family 8 subfamily B member 101
Synonyms: GA_x6K02T2PVTD-31787920-31788864, MOR162-4, Olfr888
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258416
Homologene: 84577
Gsap
Name: gamma-secretase activating protein
Synonyms: A530088I07Rik, Pion
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212167
Homologene: 45504
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Sis
Name: sucrase isomaltase
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69983
Homologene: 37424
Cyp2j7
Name: cytochrome P450, family 2, subfamily j, polypeptide 7
Synonyms: OTTMUSG00000007941, Cyp2j7-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 546837
HGNC: HGNC:2634
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f, Myhs-f1, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Gpr142
Name: G protein-coupled receptor 142
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217302
Homologene: 18770
Cby2
Name: chibby family member 2
Synonyms: 1700086N05Rik, Nurit, Spert
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67926
VEGA: 14
Homologene: 12213
Trim30b
Name: tripartite motif-containing 30B
Synonyms: Trim30-1, A530023O14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244183
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Bap1
Name: Brca1 associated protein 1
Synonyms: 2300006C11Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 104416
HGNC: HGNC:950
Homologene: 3421
Dab2
Name: disabled 2, mitogen-responsive phosphoprotein
Synonyms: D15Wsu122e, 5730435J12Rik, p96, D630005B22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13132
HGNC: HGNC:2662
Homologene: 1026
Lnpk
Name: lunapark, ER junction formation factor
Synonyms: 2310011O18Rik, 4921514L11Rik, 9530051D01Rik, lunapark, Lnpk1, Lnp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69605
Homologene: 12319
Gm1110
Name: predicted gene 1110
Synonyms: LOC382064
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382064
VEGA: 9
Homologene: 78608
Tmprss13
Name: transmembrane protease, serine 13
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214531
Homologene: 12936
Hyal5
Name: hyaluronoglucosaminidase 5
Synonyms: 4933439A12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74468
Homologene: 50610
Or2n1c
Name: olfactory receptor family 2 subfamily N member 1C
Synonyms: GA_x6K02T2PSCP-2656648-2657586, MOR256-48, Olfr135
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258329
Homologene: 110603
Dsc2
Name: desmocollin 2
Synonyms: Dsc2b, Dsc2a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glur-6, Glur6, Glurbeta2, C130030K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
P2ry13
Name: purinergic receptor P2Y, G-protein coupled 13
Synonyms: 2010001L06Rik, P2Y13, SP174, Gpr86
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74191
HGNC: HGNC:4537
Homologene: 12543
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Lcmt2
Name: leucine carboxyl methyltransferase 2
Synonyms: Tyw4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329504
Homologene: 19642
Abhd2
Name: abhydrolase domain containing 2
Synonyms: LABH2, 2210009N18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54608
Homologene: 23121
Or4c52
Name: olfactory receptor family 4 subfamily C member 52
Synonyms: GA_x6K02T2Q125-51447049-51447969, MOR234-2, Olfr1263
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258790
Homologene: 45043
Ddx19b
Name: DEAD box helicase 19b
Synonyms: 4921519L13Rik, 2810457M08Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234733
HGNC: HGNC:2742
Homologene: 56032
Vmn1r196
Name: vomeronasal 1 receptor 196
Synonyms: V1rh19
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100312484
Homologene: 110880
Pp2d1
Name: protein phosphatase 2C-like domain containing 1
Synonyms: 4921523A10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 110332
VEGA: 17
Homologene: 16981
Or5t7
Name: olfactory receptor family 5 subfamily T member 17
Synonyms: GA_x6K02T2Q125-48168771-48167839, MOR179-2, Olfr1086
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258585
Homologene: 73975
Vmn2r50
Name: vomeronasal 2, receptor 50
Synonyms: EG434117
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434117
Homologene: 113703
Plod3
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonyms: lysyl hydroxylase 3, LH3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26433
HGNC: HGNC:9083
Homologene: 843
Duxf1
Name: double homeobox family member 1
Synonyms: AW822073
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100504180
Homologene: 134545
Adamts14
Name: ADAM metallopeptidase with thrombospondin type 1 motif 14
Synonyms: TS14, Adamts-14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237360
Homologene: 16383
Speer4d
Name: spermatogenesis associated glutamate (E)-rich protein 4D
Synonyms: SPEER-4D
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 360220
Homologene: 69402
Erlin1
Name: ER lipid raft associated 1
Synonyms: 2810439N09Rik, Keo4, Spfh1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226144
Homologene: 4716
Spata3
Name: spermatogenesis associated 3
Synonyms: 4930424D10Rik, 1700011N12Rik, TSARG1, 1700029H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70060
Homologene: 12517
Prp2
Name: proline rich protein 2
Synonyms: MP14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 83380
Klf1
Name: Kruppel-like transcription factor 1 (erythroid)
Synonyms: Eklf, Nan
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16596
HGNC: HGNC:6345
Homologene: 4785
Calm5
Name: calmodulin 5
Synonyms: Scarf2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 494124
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Mroh9
Name: maestro heat-like repeat family member 9
Synonyms: 4921528O07Rik, Armc11
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78258
Homologene: 123521
Iqank1
Name: IQ motif and ankyrin repeat containing 1
Synonyms: K230010J24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 432964
Homologene: 141000
Duxf3
Name: double homeobox family member 3
Synonyms: 4933403O03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74399
Krtap10-23
Name: keratin associated protein 10-23
Synonyms: Gm3250
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100041281
VEGA: 10
Homologene: 115744
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 86,024,426 bp
  • A to G, chromosome 1 at 93,438,342 bp
  • A to T, chromosome 1 at 163,038,975 bp
  • A to G, chromosome 2 at 34,678,114 bp
  • T to A, chromosome 2 at 71,841,743 bp
  • T to A, chromosome 2 at 74,551,063 bp
  • A to C, chromosome 2 at 86,677,066 bp
  • T to A, chromosome 2 at 90,015,736 bp
  • C to T, chromosome 2 at 110,000,937 bp
  • A to G, chromosome 2 at 121,140,272 bp
  • A to G, chromosome 2 at 154,877,804 bp
  • A to G, chromosome 2 at 181,340,567 bp
  • A to T, chromosome 3 at 59,210,282 bp
  • A to T, chromosome 3 at 72,920,988 bp
  • T to A, chromosome 3 at 100,142,494 bp
  • T to G, chromosome 3 at 108,266,479 bp
  • G to A, chromosome 4 at 32,562,937 bp
  • T to A, chromosome 4 at 33,944,707 bp
  • G to A, chromosome 4 at 63,861,195 bp
  • T to G, chromosome 4 at 66,839,850 bp
  • T to A, chromosome 4 at 96,215,350 bp
  • T to G, chromosome 4 at 146,654,958 bp
  • T to G, chromosome 5 at 3,605,656 bp
  • A to T, chromosome 5 at 15,620,439 bp
  • T to A, chromosome 5 at 21,194,463 bp
  • G to A, chromosome 5 at 21,971,992 bp
  • A to T, chromosome 5 at 136,990,269 bp
  • T to A, chromosome 5 at 147,527,150 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • C to A, chromosome 6 at 24,876,197 bp
  • A to T, chromosome 6 at 39,364,596 bp
  • C to A, chromosome 6 at 132,600,688 bp
  • C to A, chromosome 7 at 10,040,313 bp
  • A to G, chromosome 7 at 64,201,941 bp
  • T to A, chromosome 7 at 79,325,590 bp
  • T to G, chromosome 7 at 97,677,387 bp
  • T to A, chromosome 7 at 104,366,186 bp
  • A to C, chromosome 7 at 120,201,168 bp
  • A to G, chromosome 7 at 139,918,844 bp
  • T to G, chromosome 8 at 71,321,813 bp
  • A to T, chromosome 8 at 79,701,144 bp
  • T to C, chromosome 8 at 80,984,589 bp
  • T to A, chromosome 8 at 84,903,299 bp
  • A to T, chromosome 8 at 111,020,979 bp
  • C to T, chromosome 9 at 4,480,273 bp
  • G to A, chromosome 9 at 26,881,821 bp
  • G to T, chromosome 9 at 38,108,917 bp
  • C to A, chromosome 9 at 45,328,688 bp
  • A to T, chromosome 9 at 70,573,497 bp
  • A to G, chromosome 10 at 5,185,394 bp
  • T to A, chromosome 10 at 49,240,767 bp
  • G to A, chromosome 10 at 58,223,810 bp
  • A to C, chromosome 10 at 58,230,928 bp
  • G to A, chromosome 10 at 58,231,067 bp
  • A to G, chromosome 10 at 61,200,361 bp
  • C to A, chromosome 10 at 77,782,400 bp
  • T to A, chromosome 10 at 89,654,160 bp
  • G to T, chromosome 11 at 67,193,383 bp
  • A to G, chromosome 11 at 86,319,438 bp
  • G to A, chromosome 11 at 114,806,531 bp
  • A to G, chromosome 12 at 57,736,978 bp
  • A to G, chromosome 12 at 101,041,971 bp
  • T to A, chromosome 12 at 102,484,480 bp
  • A to G, chromosome 13 at 3,854,405 bp
  • T to A, chromosome 13 at 22,293,270 bp
  • T to C, chromosome 13 at 62,370,341 bp
  • T to A, chromosome 14 at 31,257,508 bp
  • T to A, chromosome 14 at 47,724,972 bp
  • A to T, chromosome 14 at 75,592,606 bp
  • G to A, chromosome 15 at 6,427,341 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • A to T, chromosome 15 at 11,388,314 bp
  • G to A, chromosome 15 at 76,046,754 bp
  • T to A, chromosome 16 at 32,756,749 bp
  • A to T, chromosome 17 at 38,209,174 bp
  • A to T, chromosome 17 at 53,515,770 bp
  • C to T, chromosome 18 at 20,032,274 bp
  • T to A, chromosome 18 at 63,030,466 bp
  • T to C, chromosome 19 at 6,252,579 bp
  • G to A, chromosome 19 at 36,992,465 bp
  • T to A, chromosome 19 at 44,056,159 bp
  • A to G, chromosome 19 at 47,130,713 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8062 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067498-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.